Расхождение мышц пресса: Диастаз прямых мышц живота — симптомы, признаки, степени, причины и лечение у мужчин и женщин в Москве в «СМ-Клиника»

Содержание

Диастаз прямых мышц живота | ТС Клиника — Краснодар

Плоский живот, с «кубиками» или без, — почему иногда мечта может стать недостижимой, несмотря на регулярные тренировки?
Одна из распространенных причин неэстетичного, выпуклого живота — диастаз прямых мышц живота.

 

Диастаз прямых мышц живота — состояние, когда между прямыми мышцами брюшного пресса, по срединной линии появляется расхождение, «провал», а при натуживании — аномальное выпячивание. Продольные волокна мышц отдаляются друг от друга на несколько сантиметров. 
 

ПОЧЕМУ ТРЕНИРОВКИ НЕ ПОМОГУТ?
 

Неправильно подобранный комплекс упражнений при диастазе прямых мышц живота после родов приводит к большому разочарованию – расхождение мышц может увеличиться из-за повышения внутрибрюшного давления во время занятий. А досаждающая выпуклость живота не пропадет, ведь натренировать апоневроз (ткань между мышцами) невозможно – там нет мышечных волокон и она не уменьшится после физ. упражнений.

 

КАК ОПРЕДЕЛИТЬ ДИАСТАЗ? 

Обычно  пациентов  беспокоит отвисание живота, изменение фигуры. При значительной степени диастаза могут появляться симптомы:

  • Боли, дискомфорт в животе, усиливающиеся при физических нагрузках;
  • Запоры, вздутие, тошнота;
  • Спланхоптоз – опущение, смещение органов брюшной полости с соответствующей симптоматикой;
  • Дискомфорт во время ходьбы, в положении стоя;
  • Атрофия мышц передней брюшной стенки.

Как провести диагностику диастаза самостоятельно:

  • Нужно лечь на спину, согнув ноги в коленях и опираясь стопами на поверхность пола;
  • Одну руку поднять и подложить под голову;
  • Пальцы второй руки расположить по срединно линии живота на уровне талии, над и под пупком, слегка надавливая ими на брюшную стенку;
  • Выполнять подъем верхней части туловища, одновременно скручивая торс;
  • При подъеме определить появившийся диастаз, его ширину. Обычно он чувствуется как некоторый «провал» пальцев в глубь живота, между мышцами.

По расстоянию, ощущаемому пальцами можно примерно установить диастаз прямых мышц живота, его степени. Один палец принимается за 1 см (приблизительно). В норме ширина апоневроза между прямыми мышцами (они самые поверхностные и мощные) не более 2 см.

 

ЧТО ДЕЛАТЬ?

Это именно та ситуация, когда само не пройдет. В нашем центре проводятся самые востребованные и современные операции при диастазе прямых мышц живота, применяются эндоскопические методы в соответствии с мировыми стандартами качества медицинской помощи.

 

В результате хирургического вмешательства внешний вид пациента кардинально меняется в лучшую сторону, а следы от операции  незаметны.

 

ПОСЛЕ ОПЕРАЦИИ 

После эндоскопических вмешательств пациент находится в стационаре не более 2-х суток, и уже через 14 дней может постепенно возвращаться к привычным физическим нагрузкам. Больные говорят о хорошем самочувствии уже в первые сутки после операции, т.к в большинстве случаев применяется эпидуральная анестезия, что исключает тяжелый период восстановления после общего наркоза. Бандаж при диастазе прямых мышц живота рекомендуется всем в обязательном порядке на срок 1 месяц.

Расхождение прямых мышц живота у мужчин. Как определить?

Диастаз прямых мышц живота у мужчин может быть вызван разными факторами, поэтому такая проблема не редкость в пластической хирургии. Расхождение мышечных тяжей возникает в результате растяжения сухожилия, которое представляет собой эластичную мембрану.

Диастаз возникает как следствие:

  • перенапряжения мышц пресса;
  • увеличения объема брюшной полости;
  • врожденного истончения сухожилия.

Локализация диастаза

Наибольшую ширину белая линия имеет на участке, от пупка до мечевидного отростка. Это место и является уязвимым. В норме ширина сухожильной мембраны не должна превышать 22 мм. Распознать наличие расхождения и его размер можно лежа на спине, приподняв голову или ноги. При этом будет контурироваться безболезненное выпячивание.

Клинические последствия и сопутствующие состояния

Диастаз мышц живота у мужчин может сочетаться:

  • со слабостью мышц пресса;
  • истончением апоневрозов.

Перераспределение нагрузки переходит на группу мышц спины, что со временем проявляется болями и ощущением дискомфорта в области грудного и поясничного отделов. Изменение нормального тонуса брюшной стенки может привести к опущению внутренних органов, что повлечет за собой нарушение работы пищеварительного тракта функционального характера. Стоит отметить, растяжение белой линии не является синонимом грыжи. Для нее характерно наличие грыжевых ворот, через которые при натуживании выпячиваются органы брюшной полости с последующим болезненным ущемлением или без него.

Проблема диастаза мышц живота у мужчин решается хирургическим методом. Место соединения мышц брюшного пресса укрепляется собственным сухожилием или специальной сеткой. Чтобы грамотно подобрать метод коррекции диастаза, можно записаться на предварительную консультацию к доктору Исамутдиновой Гузаль Мелисовне и задать все интересующие вопросы. Операция обеспечивает долгосрочный надежный результат.

Хирургическое лечение диастаза прямых мышц живота в Санкт-Петербурге

Имеются противопоказания. Необходима консультация специалиста.

Диастазом называется состояние, при котором увеличивается расстояние между прямыми мышцами живота. Живот при этом становится круглым, неэстетичным. Этот дефект возникает у женщин, мужчин и даже детей.

Опасность диастаза заключается в том, что он не только портит фигуру, но и значительно повышает риск образования грыжи, можно привести к атрофии мышц и опущению внутренних органов.

Согласно ширине расхождения мышц, выделяют три стадии заболевания:

  • 5-7 см;
  • 7 см;
  • более 10 см.

Симптомы могут отсутствовать, однако чаще всего сразу становится заметен обвислый живот, появляется тяжесть, боль, запоры, отрыжка, дискомфорт даже в покое.

Упражнения на пресс в этой ситуации только усугубляют дефект и увеличивают живот. Это происходит, потому что «белая линия» живота – это соединительная ткань, а она не может сократиться от физкультуры.

Причины развития заболевания

У женщин

Основная причина – беременность. Во время нее матка увеличивается в размерах и давит на «белую линию». В результате соединительная ткань растягивается и постепенно истончается. В образовании дефекта играют роль число беременностей, плотность соединительной ткани, ее растягивающие свойства. Важно учесть, что с возрастом плотность «белой линии» становится ниже. Поэтому риск образования диастаза повышается с возрастом наступления беременности.

У мужчин

Причины формирования диастаза у мужчин – лишний вес и неправильный подъем тяжестей. Мышцы живота нужно укреплять с детства, потому что после тридцати лет, если этого не делать, соединительная ткань истончится, и может появиться диастаз.

У детей

В период новорожденности это норма, потому что мышцы живота еще недостаточно окрепли. Их может легко раздвинуть даже переполненный желудок. Постепенно эта патология проходит по мере укрепления соединительной ткани и мышц. Процесс восстановления затягивается у ослабленных и недоношенных детей, а при синдроме Дауна дефект может остаться на всю жизнь.

Способы лечения

Устранить диастаз прямых мышц живота можно только хирургически, ушив образовавшийся между ними просвет.

Показания к операции:

  • наличие диастаза прямых мышц живота.

Как проходит хирургическое лечение?

На подготовительном этапе пациенту необходимо проконсультироваться с хирургом. Врач проводит осмотр, определяет объем и способ проведения операции. Далее следует стандартное предоперационное обследование:
клинический и биохимический анализы крови;

  • общий анализ мочи;
  • коагулограмма;
  • анализы крови на ВИЧ, сифилис, гепатиты В и С;
  • флюорография;
  • ЭКГ.

Результаты обследования нужно предоставить терапевту, который при отсутствии противопоказаний дает разрешение на операцию и подписывает направление. После этого надо проконсультироваться с анестезиологом.

За две недели до операции надо отказаться от курения или сократить число сигарет в два раза, от алкоголя. Накануне вечером – легкий ужин. После этого нельзя пить и есть.

Непосредственно перед операцией хирург фотографирует живот пациента, чтобы потом наглядно сравнить состояние до и после коррекции.

Операция может проводиться по двум методиками – натяжной и ненатяжной. Продолжительность – до 2 часов, применяется общий наркоз.

Натяжная техника

Прямые мышцы стягиваются и затем фиксируются в нужном положении. Подкожная клетчатка укрепляется, а живот становится плоским.

Ненатяжная методика

В область расхождения мышц устанавливается имплантат. Доступ в данном случае может быть лапароскопическим (через проколы) и открытым (через наружные разрезы по линии диастаза или складке пупка).

После операции накладываются швы, выполняется перевязка. После натяжной пластики пациенту надевается бандаж.

Способы профилактики диастаза

  • Как можно раньше начинать тренировать мышцы живота, особенно глубокие.
  • Держать под контролем вес, правильно питаться.
  • Не поднимать тяжести, а если это необходимо, то делать это правильно, принимая основную нагрузку на ноги.
  • Укреплять глубокие мышцы спины.
  • Поддерживать правильную осанку.

Убрать живот при диастазе – Медицинская клиника Иваново

Как убрать живот? Один из популярнейших вопросов. Если Вы уже перепробовали множество диет и упражнений, возможно, пора обратиться за помощью к специалистам — хирургам.

Диастаз (с греч. diastosis) – это разделение, растяжение, истончение, промежуток. Мы будем говорить про расхождение белой линии, которая соединяет прямые мышцы «пресса».

Белая линия живота не является мышцей. Это соединительная ткань, которая состоит из плотных коллагеновых и эластических волокон.

 В норме у женщин и мужчин ширина белой линии составляет 0,5 — 3 см. Всё, что больше классифицируется как диастаз прямых мышц живота, то есть увеличение расстояния между левой и правой прямыми мышцами.

Расхождение прямых мышц живота напоминает по своей сути шов на одежде. Если швы расходятся, детали перестают прилегать друг к другу плотно. То же самое происходит и с белой линией живота, когда коллаген растягивается.

Вопреки утверждениям о пользе упражнений, диастаз самостоятельно не проходит. Справиться с этим состоянием помогает только хирургия.
Внешний вид живота определяет локализация и степень диастаза: у одних он проявляется «надутым» животом, у других – вывернутым пупком.

 Обычно к хирургам приходят с жалобой на некрасивый «беременный» или «пивной» живот. Но диастаз опасен не эстетикой, а своими последствиями для здоровья.

Рано или поздно к диастазу присоединится грыжа живота, когда жир или небольшой фрагмент кишечника выходит между растянутыми волокнами белой линии. Грыжа формируется, если изводить себя нагрузками и интенсивным тренировками: качать пресс, выполнять приседания, поднимать тяжести.

Грыжа при диастазе – это бомба замедленного действия, которая несет в себе риск ущемления и некроза. Любой некроз лечится экстренным удалением ущемленного участка, и в случае с кишечником вызывает пожизненные проблемы.

 Вторая беременность при диастазе мышц живота несет в себе риск развития кислородного голодания у ребенка и слабой родовой деятельности.

Заболевание проявляется не только внешне. Из-за изменения анатомии брюшной полости, органы смещаются, нарушается их деятельность. Поэтому обычно наличие диастаза сопровождают многочисленные нарушения пищеварения со стороны кишечника —  спазмы, боли в пояснице, вздутие, метеоризм, запоры, ощущение переполнения живота. Со временем эти симптомы усиливаются, к ним присоединяется недержание мочи.

Как определить диастаз живота самостоятельно

Чтобы самой проверить живот и распознать диастаз, необходимо лечь на ровную поверхность, согнуть ноги в коленях. Положите одну руку за голову. Затем на выдохе приподнимите верхнюю часть туловища, как будто качаете пресс. Так легче обнаружить границы прямых мышц живота. Второй рукой прощупайте живот посередине, между мышцами пресса. Особенно хорошо чувствуется диастаз в районе пупка, так как анатомически белая линия живота в этом месте шире.

И не пугайтесь, когда найдете расхождение – если расстояние между мышцами не превышает 3 сантиметров, всё нормально. Больше – значит, вам необходимо запланировать встречу с хирургом. Оперироваться или нет, вы решите сами, но поставить диагноз необходимо.

Как убрать диастаз без операции? Помогут ли упражнения при диастазе мышц живота?

Если с момента родов прошло более 6 месяцев, убрать живот при диастазе без хирургического вмешательства невозможно. Ни «планка», ни «вакуум», ни массаж его не уменьшат. Что бы вы ни делали, это состояние не пройдет само, и со временем только усилится.

Диастаз у женщин

Основным пусковым фактором диастаза живота у женщин являются беременность и роды – белая линия живота растягивается и не всегда возвращается к своим первоначальным размерам.

Впрочем, и остальные факторы также имеют место быть – диастаз пресса встречается и у нерожавших. Также диастаз может быть и у мужчин.

Как проходит операция по удалению диастаза

Существует несколько современных методик по устратению диастаза. К ним относяти эндоскопическую, и лапароскопическую, и открытую операцию. Конкретный вид операции и методику обезболивания (наркоз или анестезия) можно определить только после консультации с хирургом.

Хирург произведет осмотр, изучит анамнез и только после этого можно будет понять, какой вид операции подойдет именно Вам.

В любом случае, если потребуются внешние швы, наш хирург владеет методиками наложения косметических красивых, ровных и аккуратных швов. В отличие от врачей в частных больницах, где внимание сосредоточено на здоровье пациента и внешний вид швов врача не волнует, в нашей клинике доктор имеет задачу сделать все максимально качественно не только с точки зрения здоровья, но и для красоты.

Лазер при диастазе

В нашей клинике помимо оперативного лечения диастаза применяются вспомогательные методики с применением лазерных технологий. Лазерная подтяжка живота позволит дополнительно подтянуть живот, сделать эффект от операции еще более радующим, уплотнить кожу и улучшить ее качество. Поскольку диастаз редко обходится без растяжек и утоньшения кожи, дополнительная лазерная обработка необходима для усиления эстетического эффекта.

Диастаз прямых мышц живота — ПЕРЕСВЕТ

Диастазом  прямых мышц живота называют  расхождение прямых мышц живота, приводящее к растяжению белой линии живота.

Это состояние  чаще встречается у женщин после родов, чаще после повторных. Но  мужчины не являются исключением. Данная патология у сильного пола не является редкостью.

Отчего развивается диастаз. К его развитию чаще приводит  беременность, что объясняет более частое распространение этой патологии  у женщин. Другим фактором, который может вызвать расхождение прямых мышц, являются состояние, при которых происходит длительной повышение внутрибрюшного давления (запоры, хроническая задержка мочи, длительный хронический кашель, тяжёлые физические нагрузки). Кроме того, быстрое увеличение массы тела при сокращении физических нагрузок, тоже может явиться причиной расхождения прямых мышц живота.

При диастазе прямых мышц  не происходит формирования истинного грыжевого выпячивания, что, исключает риск развития такого грозного осложнения как ущемление грыжи.

Классификация диастаза мышц
  • Диастаз мышц живота 1 стадии – размером от 5 до 7 см
  • Диастаз мышц живота 2 стадии – размером более 7 см
  • Диастаз мышц живота 3 стадии – размером более 10 см с отвислым животом

Как правило, единственным симптомом развития диастаза прямых мышц живота является образование на передней брюшной стенке валикообразного выпячивания. И  тем не менее, именно это приносит пациентам выраженный дискомфорт, конечно же, в большей степени эмоциональный. Это обусловлено, скорее косметическим недостатком.

К сожалению, развившись однажды, диастаз прямых мышц никогда не исчезнет самостоятельно. Ни ношений бандажей, ни изнуряющие «качания» пресса не смогут устранить проблему.

Именно это обстоятельство заставляет пациентов обратиться к врачу. И тут встает вопрос, а к какому врачу обратиться с данной проблемой? Для пластических хирургов – нет простора для творчества. Для общих хирургов – нет времени и желания возиться с такой мелочевкой, в крайнем случае отдадут какому нибудь начинающему доктору для отработки навыков.

Обращайтесь в хирургическое отделение ЛДЦ ПЕРЕСВЕТ, г. Воронеж, бульвар Победы, 13. Одним из направлений нашей работы является хирургия грыж и диастазов прямых мышц живота. Мы имеем большой опыт работы в этом направлении. Итог нашей работы – четкое соблюдение анатомии белой линии и передней брюшной стенки, максимальное соблюдение косметичности при выполнении операции.

 

 

 

У Вас появились проблемы со здоровьем? Я  готов Вам  помочь! У меня есть все для вашего выздоровления!!!

 

С уважением, хирург Александр Соловьев

у кого развивается диастаз после родов

Роды позади, на руках лежит самый прекрасный малыш в мире, и нужно подумать о том, как вернуться в прежнюю форму, убрать живот и восстановить работоспособность. Но, несмотря на все усилия, результат в виде плоского живота отсутствует, а общее самочувствие только ухудшается. Почему? Добиться цели мешает распространенное состояние у новоиспеченных матерей — диастаз прямых мышц живота.
Нельзя считать диастаз только эстетической проблемой, которая мешает достичь желаемой физической формы. Это потенциальный вред для здоровья. Казалось бы, какова связь между диастазом прямых мышц живота и таких симптомов, как боль в спине, недержание мочи? Но выявлена прямая связь, объединяющая эти проблемы. Хорошая новость: специалисты клиники «Качество Жизни» избавят от диастаза консервативными методами, даже если расхождение 6-8 см.

Диастаз: определение понятия


Живот имеет мощную мускулатуру и можно выделить следующие основные группы:
• внешние — косые и прямая мышцы, последняя образует столь желанные «кубики» на животе;
• внутренние — поперечная и косые мышцы, их главная задача – поддерживать положение органов.
Прямые мышцы разделены тонкой сухожильной перепонкой – она же белая линия. От ее послеродового состояния зависит многое. В норме расстояние между мышцами не более 20 мм. Но под действием определенных причин сухожильная мембрана ослабляется, чрезмерно растягивается, а соседние мышцы расходятся. Такое состояние называют диастазом прямых мышц живота.
Выделено несколько видов диастаза. В основе классификации лежит область расхождения: над или под пупком, либо смешанный вариант. Именно от этого во многом зависят симптомы и прогноз.

Причины


Диагноз «диастаз» выставляется 2-3 из 10 женщинам после рождения малыша. Определены и группы риска: вероятность расхождения прямых мышц выше у обладательниц хрупкого телосложения, не занимающихся спортом. Рискуют и многодетные матери детей с небольшой разницей в возрасте.

Статистически реже диастаз регистрируется у активных женщин, с развитыми и тренированными прямыми мышцами живота и нормальным весом.

Отмечается прямая связь между неправильно функционирующей мускулатурой грудобрюшной диафрагмы, дна малого таза и живота, и нарушением их слаженной работы, что приводит к их дисфункции. Это одна из причин увеличения внутрибрюшного давления и, приводит, как следствие, к диастазу.
Беременность и роды – еще одни явные причины увеличения внутрибрюшного давления. Объяснений этому несколько: рост плода и матки. Роль играет выработка гормона релаксина, способствующего «размягчению» связочного аппарата костей таза для возможности естественных родов. Но релаксин действует и на белую линию, что может провоцировать ее слабость и как следствие формирование диастаза.

Предрасполагающими факторами в развитии диастаза с его возможными осложнениями можно считать беременность двойней или тройней, большой вес плода к моменту родов, тяжелое и длительное родоразрешение.

Диастаз вполне возможен у мужчин и даже у детей. Поэтому беременность, рождение ребенка — не единственные причины, есть и другие:
• Врожденные особенности
Белая линия (апоневроз) образована соединительной тканью. При ее врожденной слабости значительно увеличивается вероятность того, что мышцы начнут расходиться. Для профилактики осложнений важно выявить предрасположенность к расхождению еще до беременности, предпринимая профилактические меры: их укрепление методами лечебной гимнастики.
• Болезни и нарушения функций кишечника
Хронический запор – одна из причин повышенного внутрибрюшного давления. Его длительное существование в сочетании с другими факторами повышает риск расхождения. В целом опасны быстрый набор веса, ожирение, малоактивный образ жизни и ряд хронических заболеваний, одним из симптомов которых является повышение внутрибрюшного давления.
• Силовые тренировки
Рискуют столкнуться с диастазом люди, практикующие тяжелые силовые тренировки. Тренерские ошибки, излишняя нагрузка – не только фактор риска диастаза, но и его осложнений, например, пупочной грыжи.

Крайне важно выявить расхождение мускулатуры своевременно, иначе неправильно подобранный комплекс занятий, тренирующих живот и его мускулатуру, особенно в период послеродового восстановления, приведет к серьезным осложнениям – усилению расхождения между мышцами.

Как самостоятельно определить диастаз?


При подготовке к беременности рекомендовано посещение целого ряда врачей и выявление диастаза, предрасположенности к нему — один из пунктов обязательного обследования. В клинике «Качество Жизни» специалисты не только смогут выявить, но и устранить проблему нехирургическими методами, помогая быстрее восстановиться после родов, избежав осложнений.
Расхождение прямых мышц выявляется самостоятельно, при этом не нужны сложные методы обследования – если напрячь живот, то по его центру заметен продольный валик, как раз в области белой линии. Существуют и другие тесты, доступные в домашних условиях:
• займите лежачее положение, слегка согнув ноги в области колен;
• правая или левая рука должна расположиться в области затылка;
• пальцами другой руки, ориентируясь по пупку, найдите среднюю линию;
• поднимая вверх и одновременно скручивая торс, пальцами нужно искать «провал».
Если на животе провал не более двух сантиметров, ориентировочно 1-1,5 пальца — повода для переживаний нет. Но в рамках планирования беременности консультация врача не помещает.
В зависимости от величины расхождения, выделяют следующие степени диастаза:
• I – не превышает 22-50 мм;
• II — около 51-70 мм;
• III – более 71 мм. В таком случае выпячивание постоянное, не зависит от натуживания, изменяется его конфигурация.

Сразу после рождения малыша мышцы могут разойтись на величину до 3 см – это вариант нормы. Чтобы сократить срок восстановления, не допуская осложнений, нужна медицинская помощь в раннем послеродовом периоде.

Чем опасно расхождение?


Самые яркие последствия диастаза – выпуклый живот и изменение его конфигурации и фигуры в целом. Наиболее выраженными симптомы становятся спустя 2-3 месяца после родоразрешения. В попытках вернуть прежнюю форму, женщины принимаются за активные физические упражнения. Но проблема остается и даже становится более серьезной и выраженной.
Диастаз – это далеко не только эстетическая проблема. При нарушении целостности брюшной стенки, вызванной расхождением прямых мышц, возникают типичные жалобы: боль в зоне поясницы, расстройство венозного кровотока в малом тазу, застойные явления в венах голеней и бедер, что способствует развитию варикозной болезни и угрозе тромбообразования. Еще это одна из причин опущения внутренних органов, что является предрасполагающим фактором и причиной недержания мочи, частых циститов (воспаление мочевого пузыря).

Нередки и проблемы со стороны пищеварительного тракта – хронический запор, диспепсические расстройства: боль или дискомфорт, чувство быстрого насыщения, бурления в животе, тошнота, вплоть до рвоты, отрыжка и изжога.

Лучшее лечение диастаза и его осложнений – профилактика, ведь снизить его вероятность возможно. Главное — укрепить мышцы еще на этапе планирования беременности. Тогда даже сформировавшаяся проблема уйдет самостоятельно и безболезненно.

Лечение

При обнаружении диастаза прямых мышц живота, возникающего спустя несколько недель с момента родов, важно не волноваться. Главное – своевременно выявить проблему и начать лечение, под контролем специалистов. Обычно восстановление длится 10 недель, за это время мышцы начинают смещаться к центру. Но этих «поверхностных» изменений недостаточно, необходимо еще и восстановление структуры тканей, на которое приходится значительно больше времени – 8-12 месяцев.
В клинике «Качество Жизни» специалисты готовы помочь существенно сократить восстановительный период и избежать хирургического лечения (результаты уже через 7-10 недель), даже если расхождение составляет 6-8 см.
Имеются успешные случаи восстановления. И практика показывает, что чаще хирургическое вмешательство, даже при II степени диастаза, является крайней мерой.
Самостоятельно избавиться от расхождения невозможно, а неправильно подобранный комплекс мер только усугубляет состояние. Необходим контроль специалиста, индивидуальный подбор упражнений, учитывающих клиническую картину.
Лечение диастаза может осуществляться 2 способами, и выбор определяется его степенью и самочувствием пациентки:
• Консервативное лечение
Комплекс, включающий регулярное выполнение лечебной и дыхательной гимнастики, курс массажа, ношение бандажа и тейпов и другие рекомендации, касающиеся образа жизни, питания.
• Хирургическое лечение
После обязательно следует период реабилитации, включающий методы ЛФК, кинезиотейпирование и др.

Если причина расхождения мышц болезни пищеварительного тракта, легких, то их необходимо лечить как первопричину. Иначе избавиться от проблемы сложнее, и высока вероятность рецидива. Добиться плоского живота также невозможно.

Методы лечебной физкультуры


Главная задача лечебной физкультуры (ЛФК) запустить поперечную мускулатуру живота, а также тазового дна, диафрагмы, это способствует нормализации внутрибрюшного давления, тем самым устраняют основной провоцирующий фактор. Во многих случаях, ЛФК предшествует остеопатическое лечение. Оно создает основу, каркас для дальнейшей работы, «размягчает» тело, облегчая дальнейшую работу при помощи лечебной гимнастики.
Лечебная физкультура, безусловно, важна и полезна, но при диастазе далеко не все упражнения разрешены. Некоторые из них могут оказаться опасными и причинить вред, то есть усугубить ситуацию.

ЛФК и комплекс гимнастических мероприятий должен быть предварительно одобрен врачом и проводиться под его контролем, дать правильную и безопасную нагрузку мышцам может только врач.

Существуют упражнения, которые при расхождении категорически запрещены:
• упражнения с фитболом лежа на спине;
• некоторые асаны йоги, подразумевающие воздействие на мышцы пресса;
• упражнения на пресс, скручивания торса;
• категорически запрещены упражнения с поднятием тяжестей, да и в повседневной жизни нельзя поднимать груз весом больше 4-5 кг.
Лечебная гимнастика осуществляется по алгоритму и преследует несколько целей:
• первый этап лечения – подготовительный, его основная задача – подготовить мышцы для дальнейшей работы с ними, что может продолжаться до 2-х месяцев;
• укрепление и тренировка поперечной мышцы обеспечивает поддержание внутренних органов в правильном положении, что можно рассматривать как профилактику многочисленных заболеваний и состояний.
Рекомендованный комплекс упражнений должен выполняться регулярно и на постоянной основе. Раз в неделю необходим диагностический тест, позволяющий оценить результаты лечения.

Консервативное лечение – это длительная и сложная работа, поэтому не стоит ждать моментальных результатов. Но главное преимущество — возможность избежать оперативного вмешательства и минимизировать последствия.

Кинезиотейпирование


Тейп-ленты, наклеенные на живот по специальной схеме, являются эффективным методом лечения, который в дополнении с другими методиками позволяет быстрее получить результат.
Кинезиотейпирование живота позволяет добиться следующих эффектов:
• стабилизировать мышцы;
• избавить от неприятных и даже болезненных ощущений;
• устранить перерастяжение и не допустить его прогрессии;
• обеспечить мышцам необходимый тонус;
• стимулировать обменные процессы.

Для достижения максимального эффекта тейпы должен устанавливать специалист по схеме. Но лечебный эффект достигается только при сочетании тейпирования и лечебной гимнастики продолжительностью несколько месяцев.

Коррекция питания и образа жизни

Питание всегда, независимо от состояния здоровья, должно быть разнообразным и обеспечивать потребности в питательных веществах, витаминах и минералах. Но при диастазе от продуктов, способствующих газообразованию и метеоризму, необходимо отказаться (бобовые, капуста, большое количество сладостей и др.).

Основу рациона должны составлять продукты, стимулирующие нормальную работу кишечника: молочные и кисломолочные, содержащие клетчатку, свежие фрукты и овощи. При соблюдении рекомендаций риск диастаза ниже на 40%.

Поза для сна также имеет значение. При диастазе наиболее оптимальной считается сон на боку или спине. От привычки спать на животе необходимо отказаться. Дело в том, что способствует усилению нагрузки на белую линию, из-за чего мышцы подвержены дополнительному растяжению. Вставать с постели утром рекомендовано с положения на боку, а основная мышечная нагрузка должна распространяться именно на мышцы ног.

Изменения в осанке, происходящие при беременности, усугубляют расхождение мускулатуры живота, поэтому воздействие должно быть комплексным. Важно действовать быстро, чтобы не сформировался порочный круг: диастаз ухудшает осанку, а осанка – диастаз.

Лечение после кесарева сечения

Рубец, формирующийся после кесарева сечения, мешает полноценной работе грудобрюшной диафрагмы и мускулатуры тазового дна. В совокупности именно эти факторы предрасполагают к повышению внутрибрюшного давления, что способствует расхождению мускулатуры живота. При реабилитации и лечении важно работать с рубцом, сделать его более мягким, податливым.
Мягкие остеопатические техники, позволяют сделать его более податливыми, что и даст возможность работать с мускулатурой пресса и тазового дна, диафрагмой, но и предотвратить спаечные процессы и увеличить вероятность естественных родов в будущем.

Работа с рубцом после кесарева сечения позволят создать правильные предпосылки для лечебной физкультуры. Это позволяет убрать «жесткость» тела и основных областей тела, необходимых для лечения диастаза.

Реабилитация после хирургического вмешательства

Если мускулатура расходится более чем на 10 см, возможно, понадобится хирургическое лечение, имеющее строгие показания. Но даже после такого лечения следует период реабилитации.
Уже спустя 10-14 недель после хирургического лечения, пациентам рекомендовано вернуться к привычной жизни, и разрешаются нагрузки. Но лечебная гимнастика, то есть комплекс упражнений, направленный на скорейшее восстановление, разрешен гораздо раньше.
Сценарий восстановления и комплекс упражнений подбираются индивидуально, и это зависит от целого ряда факторов:
• методика оперативного лечения: эндоскопическое, классическое хирургическое;
• степень диастаза и расхождение в сантиметрах;
• состояние пациента;
• и др.
Но даже после хирургического лечения высока вероятность рецидива, поэтому без лечебной гимнастики никак не обойтись. Лишь правильно подобранный комплекс упражнений, контроль специалиста и регулярное их выполнение – залог полного выздоровления, нормализации состояния.

Важно чтобы комплекс профилактических упражнений был составлен специалистом. Некоторые из них требуют некоего обучения. Важно правильно их выполнять, иначе — вреда будет больше, чем пользы.

Меры профилактики и преимущества клиники «Качество Жизни»

«Любое заболевание и состояние гораздо легче предупредить, чем после вылечить» – неписаное правило современной медицины. Избежать диастаза в послеродовом периоде вполне возможно, главное — комплексный подход и своевременное начало действий.
В идеале посетить врача необходимо еще на этапе подготовки к беременности. Меры по профилактике помогут избежать целого ряда проблем в период вынашивания долгожданного малыша и после родов.
К числу рекомендованных мер по профилактике диастаза можно отнести:
• нельзя поднимать тяжести, нужно заручиться поддержкой близких;
• вставая, нужно опираться на руки, а вес тела стараться перемещать на ноги;
• исключить упражнения, тренирующие прямые мышцы живота;
• разрешенные упражнения направлены исключительно на укрепление глубоко расположенную мускулатуру малого таза и живота.

Рождение ребенка – одна из главных жизненных миссий женщины. Но все имеет свою цену. Не стоит паниковать при обнаружении проблем, сразу после рождения малыша. Специалисты клиники «Качество Жизни» имеют большой опыт в лечении диастаза, разработают эффективный комплекс упражнений, который поможет быстро, безболезненно и безопасно решить проблему и избавиться от возможных последствий. Главное – своевременно обратиться за помощью и начать восстановление как можно раньше.

Упражнения на пресс при диастазе прямых мышц живота! — 113 ответов

Вот нашла интересную статью. И решила поделиться  для меня это очень актуальная тема. Так как многие даже не знают что у них есть диастаз (((


 источник http://www.baby.ru/blogs/post/149027073-18025409/

 Вы питаетесь сбалансировано, регулярно выполняете упражнения для пресса, а животик все равно продолжает оставаться неэстетичным, выпуклым и даже растет? Возможно, у вас диастаз. Что это такое и как с ним бороться, давайте разбираться вместе.  

Диастаз, чаще всего, появляется после беременности и представляет собой расхождение прямых мышц живота, вследствие сильного давления, в том случае, если плод крупный. Иногда причиной диастаза может быть наследственная предрасположенность к нему или слабые мышцы пресса.  

Помимо того, что обвисший живот при диастазе выглядит неэстетично, так это еще и чревато появлением грыж, нарушением пищеварения, опущением внутренних органов, проблемами с осанкой и позвоночником. Особое внимание борьбе с диастазом должны уделить женщины, планирующие следующую беременность, поскольку ослабленный мышечный корсет живота затруднит потуги и увеличит вероятность родовых травм у будущего ребенка.  

По ширине расхождения мышц диастаз бывает трех степеней. Первая степень соответствует расхождению мышц на 5-7 см. Вторая степень – 7-10 см. Третья степень – свыше 10см.  

Диагностировать диастаз можно самостоятельно. Для этого нужно лечь, согнуть ноги в коленях, стопы расположить на горизонтальной поверхности и подвинуть как можно ближе к ягодицам. Из этого положения приподнимите голову и плечи. Задержитесь в этой позе и в центре живота нащупайте впадинку. Особенно выразительно она прощупывается под пупком или над ним.  


Это и есть диастаз. Если углубление по ощущениям достигает 5 см и больше, это повод бить тревогу.  

Косвенно о наличии диастаза вам подскажут боли в спине, изменение формы пупка с вогнутой на выгнутую, непропорционально широкая талия, наличие жировых отложений именно в районе живота, отсутствие эффекта от выполнения упражнений для пресса.  

Первое, что следует предпринять – это прекратить классические тренировки пресса. В противном случае, все ваши усилия будут вести к увеличению диастаза и, как следствие, росту живота. Вот упражнения, которые должны оказаться под запретом:  

1. Подъем прямых ног из положения лежа на спине.  


2. Подъемы плеч и корпуса из положения лежа на спине. 


3. Отжимания от пола и другие упражнения в упоре на ладони или локти.  


При диастазе, вся тренировка брюшных мышц должна выглядеть следующим образом. Втяните живот в себя и как бы потянитесь пупком к позвоночнику. Чередуйте втягивание и расслабление живота. У вас должны получиться быстрые пульсирующие движения. Дышите при этом ровно, дыхание старайтесь не задерживать. Выполните 100 таких пульсаций брюшными мышцами. За день старайтесь выполнить 5 подходов по такому упражнению. Положение, в котором вы находитесь при этом (сидя, стоя, лежа), не имеет никакого значения и не оказывает влияния на эффективность выполнения упражнения. Вы даже можете совмещать пульсацию с просмотром телевизора или чтением книги.
Это удивительное упражнение хорошо еще и тем, что, выполняя его, Вы автоматически делаете и упражнения Кегеля, тренируя мышцы тазового дна.  

При диастазе эффективно так называемое упражнение «Кошка». Для его выполнения встаньте на четвереньки. Выгните спину дугой, а живот втяните. Затем, наоборот, прогните спину дугой вовнутрь, живот держите втянутым.  



Следующие упражнения для тренировки мышц пресса при диастазе выполняются в положении лежа. Колени согните, стопы расположите параллельно друг другу. На выдохе оторвите ягодицы от пола, одновременно втяните живот и напрягите мышца пресса. На вдохе вернитесь в исходное положение. Повторите упражнение 10-15 раз.  


Исходное положение не меняем. Теперь на выдохе поднимайте голову от пола и прижимайте подбородок к груди. Живот при этом должен быть втянут. На вдохе вернитесь в исходное положение. Повторите упражнение 10-15 раз.  


Это упражнение принципиально отличается от классической тренировки пресса, когда мы отрываем от пола плечи или поднимаем весь корпус, тем, что живот остается втянутым.  

Исходное положение остается прежним. Будем выполнять растяжку поясницы. Для этого поверните голову в одну сторону, а согнутые в коленях ноги в противоположную. Задержитесь в этом положении и выполните упражнение в зеркальном отражении. Важно сохранять живот втянутым. Повторите упражнение по 10-15 раз в каждую сторону.  


Немного сменим исходное положение, и согнутые в коленях ноги оторвем от пола. Колени должны располагаться точно над тазом. Из этого положения медленно опустите на пол одну ногу и, скользя пяткой по полу, выпрямите ее. Затем медленно верните ее в исходное положение. Живот должен оставаться втянутым. Далее повторите упражнение с другой ноги. Повторите упражнение по 10-15 раз в каждую сторону.  



Все вышеописанные упражнения призваны укрепить мышцы пресса и устранить диастаз, но отнюдь не заменяют профессиональную консультацию у врача. Поэтому, прежде чем приступить к вышеописанным тренировкам, посоветуйтесь со специалистом.  


Здоровых и подтянутых животиков вам!

 

Расхождение мышц живота. Диастаз после родов

О том, что у них развился диастаз прямых мышц живота, большинство женщин узнают после родов. В период вынашивания организм значительно меняется. В связи с ростом плода происходит растяжение и деформация мышц живота, что является одним из условий формирования достаточного пространства в утробе матери.

После родов некоторое время длится период восстановления фигуры, который не всегда заканчивается полным возвращением к норме.Диастаз прямых мышц живота может развиваться и у мужчин, склонных к полноте, ожирению, а также в результате повышенных силовых нагрузок. Каков характер патологического состояния? Как определить развитие диастаза? Чем можно лечить диастаз прямых мышц живота у женщин и мужчин?

Причины и признаки диастаза мышц

Мышцы называются «прямыми» не просто так, потому что они параллельны друг другу, проходят прямо вдоль брюшной полости.В норме так называемая белая линия, область соединения мышц, образующих стенку брюшной полости, достигает максимальной ширины 2,5-2,7 см у пупка. Эти соединительные волокна достаточно эластичны и препятствуют сильному растяжению. Резкое увеличение живота, как у женщин при беременности или быстро набирающий вес у мужчин, приводит к истощению волокон белой линии. Прямые мышцы расходятся в разные стороны, а в области средней линии образуется своеобразное выпячивание передней брюшной стенки.

Что вызывает это анатомическое изменение? Как уже упоминалось, у женщин чаще всего из-за беременности. Как именно это происходит и почему?

Диастаз прямых мышц живота у женщин: роды и другие причины

Ожидание материнства – один из самых прекрасных периодов в жизни каждой женщины. Целых девять месяцев женский организм перестраивается, приспосабливается, меняется, чтобы подарить новую полноценную жизнь. При этом женщина жертвует своей фигурой. После рождения первого ребенка последствия могут быть не такими значительными, а вот второго, третьего… Сразу стоит уточнить, что необратимые изменения – это индивидуальный процесс. Например, диастаз после первых родов может образоваться только у одной роженицы из ста рожениц, а при вторичной беременности статистика уже более строгая – у двух из трех.

Читайте также:

Итак, за девять месяцев периода беременности и после родов наблюдаются следующие изменения женской фигуры:

  • чрезмерная прибавка в весе, часть которой может не исчезнуть со временем;
  • целлюлит;
  • растяжек на коже живота, груди, рук, внутренней поверхности бедер;
  • расширение, округление бедер, формирование «ушек»;
  • утолщение ягодиц, потеря эластичности;
  • увеличение молочных желез, которое затем грозит обвисанием, изменением формы груди;
  • расхождение прямых мышц живота в стороны (диастаз).
  • Это означает, что беременность может быть определена как одна из основных причин развития заболевания (50-65% случаев диагностируется в последнем триместре или сразу после родов). Другие причины включают в себя:
  • повышенное внутрибрюшное давление;
  • пролапс, смещение внутренних органов;
  • врожденных дефектов брюшной стенки;
  • резкое, неправильное похудение (строгие диеты, голодание без должной физической коррекции мышц).

Мужчинам, конечно, беременность не грозит, но другие факторы воздействия вполне могут вызвать расхождение мышц. К ним относятся:

  • «пивной живот»;
  • внезапные изменения веса;
  • неправильная тренировка мышц живота;
  • поднятие тяжестей;
  • частые запоры;
  • метеоризм желудочно-кишечного тракта;
  • кашель курильщика;
  • врожденная слабость соединительных волокон.

Наличие характерных признаков, каждый может попробовать определить диастаз в области прямых мышц живота. Исследование проводят в положении лежа (на спине), ноги слегка согнуты в коленях, голова наклонена вперед. Напрягите мышцы живота. Если полость пальпируется (видна) по средней линии, у вас явно диастаз. Также важно определить объем расхождения мышц, что в итоге укажет на степень развития заболевания:

  • I стадия: расхождение 5-7 см, практически не видно визуально, существенно не влияет на самочувствие, чаще всего диагностируется у рожениц;
  • II стадия: в области пупка преобладает расхождение 7-10 см, уже хорошо пальпируются распущенные мышцы, появляется округлость живота;
  • III стадия: расхождение более 10 см, наблюдаемое по всей длине белой линии, заметное внешне и при пальпации.

Как правило, заболевание относится скорее к приобретенным эстетическим дефектам, чем к серьезным анатомическим патологиям. Однако его наличие увеличивает риск грыжи пупка (выпячивание, выпадение, выход органа из области нормального расположения). Внутренние органы брюшной полости также могут менять свое расположение, что вызывает проблемы с их нормальной функциональностью, например, сбои в работе желудочно-кишечного тракта.

Существует ли лечение диастаза прямых мышц живота?

Первая и вторая стадии болезни не наносят существенного вреда здоровью человека.Они могут оставаться эстетическим дефектом, заметность которого снижается под влиянием комплекса специальных тренировок. Их задача:


  • привести мышцы в тонус;
  • усиливают кровоснабжение ослабленных участков.

Продолжительность периода коррекции варьируется, но в среднем составляет около 12 месяцев. Также потребуется скорректировать рацион и режим питания, установить для себя нормальный режим дня. Осуществлять регулярный контроль за состоянием организма.Не слишком усердствовать на тренировках, ну и не шарить. Избавьтесь от вредных привычек и злоупотреблений, больше времени проводите на свежем воздухе, в общем – ведите полноценный активный образ жизни.

Но вернуть белую линию к нормальному размеру не получится. В третьей стадии, когда уже возникли явные нарушения внутри брюшной полости, вызванные чрезмерным растяжением соединительных тканей брюшной стенки, применяют радикальные лечебные мероприятия, предполагающие хирургическое вмешательство.

При лечении заболевания также предусмотрены специальные протезы. Но с ними есть проблемы. Постоянное ношение может спровоцировать атрофию тканей под повязкой, опрелости, дерматиты, ссадины. При грыже не рекомендуется использовать бандаж, так как это может привести к защемлению, невозможности дальнейшего вправления.

Это значит, что есть физические упражнения для мышц живота, которые помогут уменьшить проявления диастаза. Сюда входят как специальные комплексы ЛФК, так и лечебное плавание, бег, ходьба.Комплекс подбирается с учетом степени заболевания и физических возможностей больного.

Трудно охватить весь спектр задач, которые можно выполнять при диастазе. А вот чего точно не стоит делать во время тренировки, так это следующих упражнений:

  • «велосипед»;
  • скручивание;
  • поясничных прогибов;
  • опускание и подъем ног из положения лежа;
  • отжиманий;
  • «ножницы»;
  • подъем туловища из положения лежа и в висе;
  • тяжелые прессы;
  • связан с сильным растяжением мышц брюшной стенки;
  • планка;

При таких ограничениях комплекса что остается? В рекомендации лечебной физкультуры для восстановления силы и тонуса прямых мышц живота подходят следующие упражнения:

  1. Примите лежачее положение.Руки разведены в стороны, ноги на полной стопе согнуты в коленях. Теперь поднимите таз в положение наклонного моста. Задержитесь в верхней точке, напрягите мышцы ягодиц и пресса. Это упражнение выполняется в несколько подходов по десятку раз.
  2. Оставаясь в этом положении, положите руки вдоль туловища. Теперь поочередно поднимайте каждую ногу вверх до полного выпрямления, туловище в это время также поднимается (аналогично «мостику», но с выброшенной вперед нижней конечностью). Количество повторений аналогично первому упражнению.
  3. Продолжай лгать. Руки вытянуты вперед, теперь поднимите голову, согнув шею, как бы пытаясь коснуться подбородком груди. Остальное тело остается неподвижным.
  4. «Ходьба по воздуху» выполняется из положения лежа. Руки закинуты за голову, ноги прямые. Теперь имитируем ходьбу на прямых ногах, постепенно приближая ноги к туловищу. Желательно «пройтись» 15-20 раз, перерыв и еще два таких подхода.
  5. Для следующего упражнения вам нужно будет встать, полностью прижаться корпусом к стене, ноги немного вперед, колени прямые.Поместите небольшой мяч между коленями, крепко держите. Руки упираются в стену. Теперь, удерживая мяч, согните ноги под прямым углом, скользя вниз по стене. Задержитесь в этом положении на полминуты, вернитесь в исходное положение.
  6. Всем известная «кошка» — отличный способ потренировать прямые мышцы. Нужно встать на четвереньки, на вдохе спина вошла в дугу, живот медленно втянулся. На выдохе – расслабился, вернулся в исходное положение без обратного прогиба.

Каждое из предложенных упражнений делается не менее 10 раз, количество подходов от трех. Разнообразие нагрузок во время тренировки также приветствуется, это позволит разносторонне стимулировать мышцы. Регулярность занятий и правильное выполнение заданий показали, что многие добиваются первых положительных результатов через 4-6 недель при условии не менее трех тренировок в неделю.

До рождения ребенка все мысли матери заняты только крохой.Выбор коляски, кроватки, покупка одежды для новорожденного, просмотр десятков видео на тему родов – все это досуг беременной женщины. После рождения малыша все мамы, кормящие грудью и занимающиеся спортом, должны уверенно вернуться в прежние формы. Если этого не происходит, и животик никуда не исчезает, принято говорить о диастазе.

Что такое диастаз прямой мышцы живота?

Это расхождение прямых мышц живота женщины относительно средней линии живота.В большинстве случаев опасности здесь нет. Однако дискомфорт от не выходящего животика есть, а это чревато переживаниями, раздражительностью, что никак не пойдет на пользу ребенку и папе.

Что делает молодая мама при подозрении на диастаз прямых мышц живота? Разумеется, он ищет совета, помощи и методов борьбы в Интернете. Во-первых, она сталкивается со своими худшими страхами:

  • брюшные мышцы никогда не восстановятся;
  • это тяжелая травма живота;
  • тут без операции не обойтись;
  • боль и вздутие живота станут вашими постоянными спутниками.

Все это даст понять женщине, что диастаз – серьезное заболевание, а значит, пора готовиться к операции. Но не спешите настраиваться на худшее, все вышеперечисленные гипотезы абсолютно беспочвенны и не соответствуют действительности. Серьезные причины. Беспокоиться можно только в том случае, если у вас самая тяжелая форма диастаза – расхождение прямых мышц живота более чем на 10 см.

Как определить диастаз прямых мышц живота?

Женщина способна обнаружить диастаз по следующим признакам:

  • лежа на спине заметно углубление в центре живота, колени при этом согнуты, стопы касаются пола;
  • необходимо прощупать живот в том же положении, областью интереса является пупок, а именно расстояние 3-5 см выше и ниже его;
  • при попытке натянуть пресс появляется выступ.


Чаще всего в группу риска входят женщины, имеющие двух и более детей, с многоплодной беременностью и с многоводием. Диастаз первой степени может образоваться и после первой беременности, но он абсолютно безвреден. Неестественная форма живота и выпирающий снизу живот – признаки диастаза второй степени. Некрасивый (неэстетичный) живот и выпирающие грыжи – повод начать беспокоиться, ведь это верный признак диастаза третьей степени.Пора планировать визит к врачу и начинать лечение.

Причины диастаза прямых мышц живота

У беременных все объясняется просто: матка растет и уверенно производит давление на переднюю брюшную стенку. Если при планировании ребенка вы не уделили должного внимания прессе, то такая проверка ему не под силу. Плод тем временем растет, происходит разрастание соединительной ткани, не имеющее бесконечного запаса прочности.В результате мышцы расходятся.

Также это заболевание часто встречается у мужчин, а также может возникать у никогда не рожавших женщин из-за чрезмерного увеличения массы тела, неправильной техники выполнения спортивных упражнений. Иногда это могут быть неправильно подобранные упражнения под тип фигуры человека или в соответствии с его физическими возможностями.

Упражнения при диастазе прямых мышц живота

Важно понимать, что эта проблема не исчезнет сама собой.Надеяться, что со временем ваш животик станет идеальным сам по себе, глупо. Если растяжение мышц живота слабо выражено (1 или 2 степень), то у вас есть все шансы справиться с напастью самостоятельно.

Для этого существует специальный комплекс упражнений, которые при регулярном и добросовестном выполнении принесут результат в короткие сроки. Так что же это за упражнения?

Особое внимание уделяйте дыханию — при вдыхании воздуха не надувайте живот слишком сильно.



Тазовые подъемники. Лягте на спину, ноги согните в коленях. Медленно поднимайте и опускайте таз, немного задерживаясь в верхней точке. Следите за своим дыханием.



Приседания у стены. Захватите мяч коленями и присядьте под углом 90°, выпрямитесь, держась руками за стену.



Подъем ног в положении лежа. Поднять изначально выпрямленную, но согнутую в колене ногу. Только после достижения угла в 90° его следует полностью разогнуть.


Кат. Выполняется на четвереньках, спина полностью прямая, а руки на одной линии с плечами. Выдох – живот втянут, спина округлена, вдох – исходное положение.

Все упражнения достаточно выполнять 10-15 раз. Скручивания, отжимания и другие подобные нагрузки следует исключить до консультации с врачом. Первое время упражнения следует делать в бинте. Если ребенок находится на грудном вскармливании, то начинать борьбу с диастазом необходимо не ранее, чем через месяц.

У некоторых женщин, недавно ставших мамами, животик не уменьшается даже при сбалансированном питании и физических нагрузках. Они недоумевают: в чем дело? Почему нельзя вернуть прежнюю цифру? А причина кроется в диастазе мышц живота. Давайте узнаем об этой проблеме подробно.

О причинах диастаза

Прямые мышцы живота соединены между собой сеткой-пучком сухожильных волокон. Это так называемая белая линия живота – самое светлое место на фоне мышц.Расширение связки с расхождением мышц в стороны называется диастазом. Возникает из-за повышения внутрибрюшного давления, которое давит на переднюю стенку живота при росте матки. И способствует этому активная выработка гормона релаксина при беременности. Он размягчает мышечные волокна, связки, суставы таза и делает их подвижными, более эластичными. В группу риска по развитию диастаза входят женщины с многоплодной и многоплодной беременностью, многоводием, вторыми и последующими родами.

Помимо вынашивания ребенка и стресса в родах, существуют и другие факторы, способствующие развитию диастаза у женщин:

  1. Неправильные физические нагрузки при занятиях спортом.
  2. Изнурительный и продолжительный кашель после родов.
  3. Снижение мышечного тонуса из-за быстрой потери веса или чрезмерного набора веса.
  4. Естественная (врожденная) слабость связок живота.

Как определить диастаз после родов

Для этого лягте на спину на ровную поверхность.Нижние конечности необходимо согнуть в коленях, ступни плотно прижать к полу. Правую руку нужно положить за голову, живот слегка напрячь. Левой рукой нужно нащупать место, которое находится посередине живота, по средней линии. Если диастаз действительно есть, то по линии будет ощущаться расхождение мышц. Выглядит как продолговатое отверстие. А когда вы немного приподнимете голову в этом положении, на животе появится выступ в виде валика.Ямка может локализоваться над пупком или под ним, возможно, на месте самого пупка. А это риск образования пупочной грыжи.

Основным признаком диастаза является большой живот, который не уменьшается ни через неделю, ни через две, ни через три после родов, даже если женщина соблюдает диету и занимается спортом.

Лечение диастаза прямых мышц живота после родов

Женщинам следует знать, что данная патология не может быть устранена сама по себе, через некоторое время.Способы борьбы с патологией зависят от степени расхождения мышц живота. Первая и вторая степени корректируются комплексом специальных упражнений. Они направлены на укрепление косых мышц живота, передней брюшной стенки. А вот третья степень диастаза устраняется хирургическим путем.

Итак, для коррекции патологии женщинам рекомендуется втягивать и расслаблять живот каждый день, несколько раз в день. Полезно втянуть и удерживать его 20-30 секунд, испытывая при этом статическое напряжение.С этим упражнением не переусердствуйте, чтобы не доводить себя до боли.

Можно немного приподнять голову с плечами, лежа на спине с согнутыми в коленях ногами. Положение головы также необходимо зафиксировать на 20-30 секунд. А вот прямую мышцу живота, то есть пресс, качать запрещено. Это упражнение только усугубит диастаз, усилит расхождение мышц. Нельзя делать упражнения с подъемом нижней части тела, когда брюшная полость надута изнутри.

Специалисты рекомендуют женщинам с данной патологией заниматься пилатесом. Помогает укрепить мышцы живота без резких нагрузок. Пилатес будет полезен тем представительницам слабого пола, у которых проблемы со спиной после родов.

Что касается хирургического лечения диастаза, то его суть заключается в устранении диастазного отверстия, укреплении стенки брюшины. Эффект от такой операции будет функциональным и косметическим. К хирургическому вмешательству рекомендуется прибегать только в крайнем случае, то есть при третьей степени диастаза.Это может быть связано с риском внутренних осложнений.

Несмотря на то, что около 40% рожавших женщин сталкиваются с этим диастазом, не всем нужна операция. Патологию следует стараться устранять регулярным выполнением комплекса физических упражнений. Причем, чем раньше женщина начнет заниматься, тем быстрее будет заметен результат.

Диастаз после родов — что это? В нашей статье вы найдете исчерпывающую информацию о стадиях развития заболевания и методах лечения.Как избавиться от диастаза с помощью гимнастики. Также познакомьтесь с комплексом специальных упражнений для устранения расхождений на первой стадии заболевания.

Для тех, кто занимается спортом, риск расхождения мышц живота минимален

Проблема диастаза прямых мышц живота после родов возникает более чем у 20% женщин. Эта проблема выражается не только в виде косметического дефекта, но и может приводить к различным функциональным осложнениям.Своевременная диагностика и начало лечения имеют решающее значение в борьбе с диастазом.

Диастаз – это расхождение прямых мышц живота, так называемое расширение белой линии живота. Данная патология часто встречается у женщин во время беременности и после родов. Чтобы понять, что такое диастаз и как с ним бороться, следует обратиться к строению внутренних органов человека.

Прямые мышцы живота скреплены волокнами соединительной ткани.Изначально соединительная ткань представляет собой слабую мышцу, склонную к растяжению. Во время беременности повышается внутрибрюшное давление, разрастается соединительная ткань, мышцы отдаляются друг от друга.

Изменения гормонального фона способствуют появлению диастаза после родов и во время беременности. Повышается уровень гормона релаксина, который оказывает расслабляющее действие на все группы мышц, в том числе и на соединительную ткань белой линии живота. Прямые мышцы живота под влиянием внутрибрюшного давления легко расходятся все дальше и дальше друг от друга.В середине живота образуется углубление.

Расхождение мышц может появиться во время беременности и через 2-3 месяца после родов. Иногда диагностировать данную патологию сложно из-за неявных признаков первой стадии заболевания.

Опасность запущенных форм диастаза

Послеродовой диастаз не приводит к защемлению внутренних органов, например грыже. И все же эту проблему нельзя игнорировать. На начальных стадиях заболевание не доставляет особого дискомфорта, кроме косметического дефекта.Лечение нужно начинать вовремя, иначе ситуация ухудшится.

Последствия запущенного диастаза могут быть:

  • Смещение внутренних органов
  • Плохая осанка
  • Боль в спине
  • Проблемы с пищеварением
  • Риск грыжи
  • Неэффективные попытки во время родов

Стадии развития болезни

В норме расстояние между прямыми мышцами живота составляет 0,5-2 см.Расхождение мышц выше этого показателя выходит за пределы нормы и делится на стадии:


Стадия развития болезни определяет метод лечения

  1. Расширение белой линии в пределах 5-7 см. На этой стадии появляются такие признаки заболевания, как: тупые, нечастые боли в животе, тошнота, вздутие живота.
  2. Расширение белой линии на 7-10 см. Внешне становится заметной впадина посередине живота от пупка до лобковой кости.
  3. Расхождение мышц более чем на 10 см. На этой стадии заболевания часто возникают пупочные грыжи. Более серьезными последствиями могут быть атрофия мышц и смещение внутренних органов.

Как проверить, есть ли у вас расхождение белой линии живота?

Разберемся, как определить диастаз.


Продольное углубление более 2 см считается диастазом

Для этого можно провести простой тест прямо дома.Лежать на спине. Поднимите голову и плечи от пола, когда вы поднимаетесь, как будто вы делаете пресс. Если в момент напряжения посередине живота образовался валик или впадина размером более 2 см, то это патологическое расширение прямых мышц живота. Небольшое углубление между прямыми мышцами должно быть, но не более указанного размера. Точный диагноз может поставить только врач.

В любом случае при подозрении на недуг следует обратиться к хирургу.Чем раньше вы начнете решать проблему, тем легче будет с ней справиться.

Особенности лечения диастаза первой степени

На первой стадии болезни бороться с диастазом помогут специальные упражнения. Вторая и третья стадии корректируются только хирургическим путем. Стоит отметить, что заниматься лечебной гимнастикой можно только после согласования с врачом. Специалист поставит диагноз и даст необходимые рекомендации. После естественных родов заниматься спортом можно через 6 недель, а после кесарева сечения должно пройти не менее 12 недель.

Следует исключить классические виды упражнений на пресс, подъем ног из положения лежа, скручивания. Эти виды нагрузок могут только усугубить течение болезни.

Особое внимание следует уделить дыхательной гимнастике во время занятий. Правильная дыхательная гимнастика способствует укреплению глубоких мышц брюшной полости.

Плавание и бег также дают хорошие результаты.

Комплекс упражнений

Цель гимнастики при диастазе – укрепление тазового дна, проработка глубоких мышц живота, передней брюшной стенки.

Вот несколько упражнений, которые помогут убрать диастаз на начальной стадии заболевания:


Регулярные физические упражнения помогают победить диастаз

Помните, что скручивания тела при диастазе запрещены.


Упражнения для укрепления мышц живота будут эффективны только на начальной стадии заболевания.

Отдельным видом упражнений являются дыхательные упражнения. Вдохните через нос – надуйте живот, как будто это воздушный шар.Выдох – через рот сдуйте баллон. Это упражнение можно повторять много раз в течение дня.

Посмотрите видеоролик, в котором спортивный тренер наглядно показывает, как правильно выполнять упражнения для укрепления мышц живота при диастазе.

Что запрещено при диастазе?

Чтобы не усугублять течение болезни, соблюдайте некоторые рекомендации:

  1. Вставать с кровати следует из положения «лежа на боку».
  2. Носите ребенка с помощью бинта.
  3. Не поднимайте ничего тяжелее 6 кг.
  4. Не сутультесь.
  5. При кашле кладите ладонь на живот, тем самым снижая внутрибрюшное давление.
  6. Спать на животе нельзя.
  7. Упражнения, основанные на скручивании корпуса, запрещены.

Хирургическое лечение диастаза

К какому врачу мне обратиться? Хирург сможет поставить точный диагноз и назначить лечение в соответствии со стадией заболевания.Вторая и третья степень требуют хирургического вмешательства. Существует 2 основных метода устранения диастаза хирургическим путем:

  • Эластичный пластик. Местные ткани передней брюшной стенки стягивают, устраняя таким образом расхождение. Этот вид оперативного вмешательства в настоящее время применяется редко из-за его неэффективности, длительного восстановительного периода и риска рецидива.
  • Неэластичный пластик. Отверстие закрыто специальным синтетическим материалом, при этом ткани не стягивают.Со временем имплантат зарастает соединительной тканью и успешно выполняет функцию эндопротеза. Лечение диастаза имплантом считается наиболее эффективным. Он принимает на себя нагрузку, не дает растягиваться ослабленным тканям брюшины.

Хирургическое вмешательство может включать как разрез брюшной полости длиной 16-18 см, так и эндоскопический метод.

Малоинвазивное вмешательство имеет ряд преимуществ:

  • Без крупных рубцов и швов
  • Короткий реабилитационный период
  • Риск повторного расхождения мышц минимален (около 1%)

Делается 3-4 прокола в области пупка.Имплантат вживляется под общей анестезией и эндоскопическим контролем с использованием специальных инструментов. В конце операции накладывают косметический шов. Рекомендуется оставаться в стационаре в течение 1-2 дней после операции.

Как видите, начальные стадии расхождения мышц живота можно вылечить с помощью регулярных занятий специальной гимнастикой. В этом вопросе главное вовремя обратить внимание на заболевание и начать активные действия.Конечно, занятия должны быть регулярными. В лучшем случае ежедневно.


Необходимо как можно раньше начать лечение диастаза, чтобы не запустить стадии развития заболевания.

У спортивных женщин диастаз после родов встречается реже, чем у тех, кто не дружит со спортом. Подготовленные мышцы живота успешно справляются с нагрузками во время беременности и родов и быстро приходят в норму.

Если вы столкнулись с проблемой диастаза после родов, расскажите о своем опыте лечения в комментариях к этой статье.Удалось ли избавиться от проблемы самостоятельно или потребовалось хирургическое вмешательство?

Расхождение прямых мышц живота — с научной точки зрения, диастаз мышц живота — очень неприятное явление, с которым сталкиваются женщины после родов. Чаще с этой напастью сталкиваются повторнородящие и мамы, не занимающиеся спортом до и во время беременности. Давайте посмотрим, как можно избавиться от диастаза, не прибегая к хирургическим методам.

1.Причины и стадии диастаза

Расхождение прямых мышц живота при беременности происходит по двум причинам:

  • Матка значительно увеличивается в объеме и давит на внутренние органы и прямые мышцы живота, раздвигая их изнутри;
  • Вторая причина – действие релаксина. Это гормон, который вырабатывается во время беременности в организме женщины. Его роль заключается в растворении эластичных коллагеновых волокон и размягчении плотной соединительной ткани.

В результате действия этих двух факторов белая линия живота (она расположена от грудины до лобка), состоящая из соединительной ткани, размягчается и растягивается.

Врачи выделяют три стадии заболевания:

  • На первом — мышцы расходятся в области пупка на полтора-два сантиметра в ширину;
  • Второй характеризуется расхождением мышц нижней части живота — от пупка к лону;
  • На третьей стадии происходит расхождение мышц от грудины к лону на ширину более двух с половиной сантиметров, а в области пупка на третьей стадии образуется «борозда» шириной до четырех сантиметров.


Кроме того, что диастаз портит внешний вид, он еще мешает мышцам живота выполнять свое функциональное назначение — удерживать внутренние органы. В результате у женщины формируется выпирающий живот, что приносит моральный дискомфорт и снижает самооценку.

Чем ниже стадия заболевания, тем легче с ним бороться, и если на первой стадии диастаз можно победить с помощью правильно подобранных физических упражнений и, то на третьей стадии чаще всего требуется абдоминопластика ( операция по подтяжке прямых мышц живота).

2. Самодиагностика

Как понять, есть ли диастаз? Нужно лечь на спину, колени согнуть, стопы на полу. Левую руку положите под голову, а пальцы правой положите параллельно талии на уровне пупка. Теперь нужно поднять голову, пока не почувствуете напряжение мышц живота.

Пальцами нужно прощупать среднюю линию живота по всей длине и понять, нет ли между мышцами «щели».Если щель не прощупывается, то диастаза нет. Если, наоборот, ощущается депрессия, то имеется расхождение мышц.

3. Основные правила

Что делать, как помочь себе при обнаружении этого неприятного явления? Прежде чем говорить об упражнениях, которые можно и нужно выполнять при диастазе, чтобы вернуть спину животу

одно состояние, рассмотрим основные правила:

  • При диастазе противопоказаны классические привычные упражнения на пресс: подъем корпуса из положения лежа; а также чрезмерное растяжение мышц живота: упражнения на фитболе, глубокие прогибы в пояснице.
  • Укреплять нужно не внешние мышцы живота (так называемые кубики), а внутренние мышцы пресса.
  • Также противопоказаны всевозможные скручивания, езда на велосипеде, отжимания, поднятие тяжестей.

Эти упражнения не только не принесут пользы, но могут значительно усугубить состояние.

4. Полезные упражнения

Начинать выполнять упражнения для борьбы с диастазом можно уже через две-три недели после родов (при кесаревом сечении, только после согласования с акушером-гинекологом) в связи с тем, что все они являются статическими и не предполагают чрезмерной нагрузки.Вот несколько полезных упражнений:

  • Одним из самых эффективных упражнений является вакуум, а просто втягивание живота. Это упражнение можно выполнять в течение дня в любом положении: сидя, стоя и даже лежа. Нужно делать небольшие быстрые толчки животом на себя и от себя по 50 раз в три подхода. Через полтора-два месяца таких ежедневных занятий вы заметите первые результаты.
  • Классическая доска. Упражнение, при котором вес тела удерживается в стойке с упором на локти и пальцы ног.Вы можете делать планку, только если хорошо контролируете мышцы живота. Для начала попробуйте легкие виды планки с упором на колени. Три подхода по 30 секунд. Только не забывайте напрягаться и втягивать живот во время выполнения упражнения.
  • Полезные упражнения, направленные на укрепление мышц тазового дна, которые работают совместно с мышцами внутреннего пресса. Подъем ягодиц от пола. В положении лежа нужно согнуть ноги в коленях, поставить стопы на пол, поднять таз вверх и снова опустить.При этом голова, плечи и руки лежат на полу. Его также называют ягодичным мостиком. Также требуется три подхода по пятнадцать повторений.
  • Упражнения с мячом. Исходное положение и количество подходов, как и в предыдущем упражнении, ноги согнуты в коленях. Поместите мяч между коленями и сожмите его силой внутренних мышц бедер и мышц тазового дна.
  • Упражнение «Кошка». Стоя на четвереньках, прогнуть спину вверх и вниз усилием тазовых и поясничных мышц.25-30 повторений в трех подходах. Упражнение делать с втянутым животом и стараться не прогибаться назад в пояснице.

Уважаемые читатели, все рекомендации, данные в статье, носят ознакомительный характер. Не забывайте, что для того, чтобы точно поставить правильный диагноз и определить способ избавления от диастаза мышц живота, необходимо обратиться к специалисту. И желаю вам скорейшего избавления от этого неприятного явления.


Внутренняя косая мышца живота — обзор

Анатомия

Форма брюшка крупного рогатого скота зависит от возраста, веса и физиологического состояния.В норме он билатерально симметричен. Размер брюшной полости не сразу виден, потому что большая ее часть находится внутри грудной клетки. Брюшная полость ограничена краниально диафрагмой, каудально — входом в таз, дорсально — поясничными позвонками и эпиаксиальной мускулатурой, латерально и вентрально — брюшной мускулатурой. Мускулатура брюшной стенки состоит из широких экспансивных листов, которые прикрепляются с помощью образующих апоневроз соединительнотканных структур, таких как белая линия живота и предлобковое сухожилие.Мышцы живота выполняют множество функций, таких как содержание внутренних органов брюшной полости, помощь дыханию, стабилизация таза и сгибание позвоночника. Брюшная мускулатура также позволяет создавать брюшной пресс, необходимый для дефекации, мочеиспускания и родов. Брюшная стенка эластична по своей природе, что позволяет ей приспосабливаться к различным объемам.

Кожа наиболее толстая на боку коровы и становится тоньше на брюшной части живота. Наиболее заметной особенностью бока крупного рогатого скота является паралюмбальная ямка.Паралюмбальная ямка очерчена поперечными отростками поясничных позвонков, внутренней косой мышцей живота и тринадцатым ребром (рис. 14-34). Мышцы живота и их апоневрозы образуют основную фиброзно-мышечную опору вентральной и латеральной стенок живота. В формировании брюшной стенки участвуют четыре пары мышц: наружная косая мышца живота, внутренняя косая мышца живота, поперечная мышца живота и прямая мышца живота. Наиболее важными нервами на боку являются последний грудной, первый поясничный и второй поясничный нервы.Каудальные межреберные нервы иннервируют дно живота вентральнее реберной дуги. Знание этих нервов важно для обеспечения местной анестезии при выполнении лапаротомии. Вентральная часть брюшной стенки кровоснабжается краниальной и каудальной надчревными артериями и ветвями внутренней грудной и наружной половой артерий. Фланги получают кровоснабжение от париетальных ветвей аорты, важнейшей из которых, с хирургической точки зрения, является глубокая огибающая подвздошная артерия.

Самая обширная и поверхностная мышца пашины – наружная косая мышца живота. Волокна этой мышцы идут в каудо-вентральном направлении. Однако в области паралюмбальной ямки волокна видны в более горизонтальном направлении. Эта мышца заканчивается обширным апоневрозом у латерального края прямой мышцы живота. Наружная косая мышца живота начинается на латеральной стороне грудной клетки от четвертого или пятого ребра. Он прикрепляется к бугорку тазика, предлобковому сухожилию и белой линии живота посредством апоневротической ткани.Апоневроз наружной косой мышцы живота сливается с апоневрозом внутренней косой мышцы живота, образуя наружное влагалище прямой мышцы живота.

Внутренняя косая мышца живота находится непосредственно под наружной косой мышцей живота. Эта мышца хорошо развита и занимает всю боковую область от бугорка тазика до последнего ребра. Внутренняя косая мышца живота начинается от бугра тазика, поясничных поперечных отростков и грудопоясничной фасции.Его волокна направлены краниовентрально. Волокна внутренней косой мышцы живота прикрепляются к реберным хрящам или через апоневроз, который срастается с апоневрозом наружной косой мышцы живота, образуя наружное влагалище прямой мышцы живота, которое прикрепляется к белой линии живота.

Поперечная мышца живота образует самый глубокий слой мускулатуры брюшной стенки. Он наименее обширный и самый тонкий. Поперечная мышца живота начинается от поперечных отростков поясничных позвонков и медиальной части последних ребер.Он образует апоневроз на латеральном крае прямой мышцы живота, становится внутренним влагалищем прямой мышцы живота и в конечном итоге прикрепляется к белой линии живота. Волокна идут поперечно под прямым углом к ​​волокнам прямой мышцы живота. Поперечная мышца живота изнутри покрыта поперечной фасцией и брюшиной.

Прямая мышца живота ограничена вентральной частью живота и проходит по обе стороны от белой линии живота. Начинается от реберных хрящей ребер и грудины и прикрепляется к краниальной лобковой связке.Волокна прямых мышц живота ориентированы в сагиттальном направлении. Прямая мышца живота лежит внутри апоневротического влагалища, которое образовано апоневрозами наружной косой мышцы живота, внутренней косой мышцы живота и поперечной мышцы живота.

Белая линия живота образована апоневрозами наружной косой мышцы живота, внутренней косой мышцы живота и поперечной мышцы живота. Белая линия живота начинается от мечевидного отростка и прикрепляется к сухожилию предлобковой кости. Он состоит из плотной соединительной ткани, состоящей из слоев коллагеновых пучков и фибробластов.Волокна каждого листа пересекаются друг с другом, что повышает его механическую прочность. Толщина и ширина варьируют в зависимости от расположения относительно пупка. Linea значительно толще и шире на уровне пупка. Он становится тоньше и уже по мере продвижения краниально.

Нарушение мышечной оболочки и дивергенция фенотипа в двух новых мышиных моделях дефицита дисферлина | Молекулярная генетика человека

Аннотация

Поясно-конечностная мышечная дистрофия типа 2В и миопатия Миёси являются клинически различными формами мышечной дистрофии, возникающими из-за дефектов гена дисферлина.Здесь мы сообщаем о двух новых линиях мышей с дефицитом дисферлина, полученных путем (а) нацеливания генов и (б) идентификации инбредного штамма A/J, несущего вставку ретротранспозона в гене дисферлина. Мутации у этих мышей локализовались на 3′- и 5′-концах гена дисферлина. В обеих линиях мышей отсутствовал дисферлин, и у них развилась прогрессирующая мышечная дистрофия с гистопатологическими и ультраструктурными особенностями, которые очень напоминают заболевание человека. Витальное окрашивание синим красителем Эванса выявило потерю целостности сарколеммы у обеих линий мышей, сходную с наблюдаемой у мышей с дефицитом mdx и кавеолина-3.Однако, в отличие от последней группы животных, мыши с дефицитом дисферлина имеют интактный гликопротеиновый комплекс дистрофина и нормальные уровни кавеолина-3. Наши результаты показывают, что нарушение мышечной мембраны и дегенерация миофибрилл при дисферлинопатии были непосредственно опосредованы потерей дисферлина посредством нового патогенетического механизма при мышечных дистрофиях. Мы также показываем, что мутация у мышей A/J возникла между концом 1970-х и началом 1980-х годов и закрепилась в производственном племенном поголовье.Следовательно, все исследования с участием мышей A/J или мышей, происходящих от A/J, включая рекомбинантные инбредные, рекомбинантные конгенные линии и линии с замещением хромосом, должны учитывать дефект дисферлина в этих линиях. Эти новые мыши с дефицитом дисферлина должны быть полезны для выяснения патогенетического пути при дисферлинопатии и для разработки терапевтических стратегий.

ВВЕДЕНИЕ

Аутосомно-рецессивные формы мышечных дистрофий представляют собой генетически и клинически гетерогенную группу заболеваний (1, 2).Недавно было обнаружено, что две клинически различные формы мышечной дистрофии, поясно-конечностная мышечная дистрофия типа 2B (LGMD 2B) и миопатия Миоши (MM) возникают из-за дефектов гена дисферлина, DYSF (3, 4). Хотя оба расстройства характеризуются ранним началом во взрослом возрасте с прогрессирующей слабостью и выраженным повышением уровня креатинкиназы в сыворотке крови (СК), они различаются по распределению мышечной слабости в начале. При LGMD 2B преобладают слабость и атрофия проксимальных мышц, тогда как при ММ поражаются в основном дистальные мышцы.

Анализ мутаций у пациентов с ММ и LGMD 2B выявляет преимущественно одиночные нуклеотидные изменения без явных очагов мутаций и без очевидной корреляции между генотипом и распределением мышечной слабости (5, 6). Более того, одна и та же мутация в DYSF может вызывать либо LGMD 2B, либо ММ (далее называемую дисферлинопатией) даже среди представителей одного и того же родства (3, 7). Эти данные показывают, что мутации в DYSF определяют не только фенотип заболевания, но и дополнительные факторы (генетические или экологические) могут способствовать формированию паттерна мышечного заболевания.

Белок дисферлин с молекулярной массой 237 кДа повсеместно экспрессируется и локализуется в мембране мышечных клеток (8, 9). У пациентов с дисферлинопатией наблюдается заметное снижение уровня или полная потеря дисферлина в мышцах и клетках крови (8-10). Дисферлин является членом недавно признанного семейства белков, известных как «ферлины» (11–14). Биологическая функция этих белков неизвестна, но они имеют общие мотивы, особенно множественные домены C2 и один трансмембранный сегмент на карбоксильном конце.Известно, что домены C2 связывают кальций, фосфолипиды или белки, запуская сигнальные события и перенос мембраны (15), и это привело к предположению, что дисферлин важен для сигнальных путей, которые опосредуют восстановление или слияние мембран в скелетных мышцах (3, 13). Эта гипотеза частично подтверждается недавними сообщениями о том, что первый домен С2 в дисферлине связывает фосфолипиды кальций-зависимым образом и что изолированные мышечные волокна с дефицитом дисферлина дефектны в повторной герметизации разрушенных мембран (16, 17).Однако очень мало известно о сигнальном пути или механизме, участвующем в восстановлении мышечной мембраны. Кроме того, функции остальных доменов С2 в дисферлине также неизвестны.

В ходе этого исследования сообщалось, что мыши SJL являются естественной мышиной моделью дисферлинопатии, поскольку они имеют мутацию сайта сплайсинга, которая удаляет часть высококонсервативного домена C2E (18, 19). Хотя у мышей SJL развивается активная миопатия примерно в возрасте 6–8 месяцев и наблюдается заметное снижение (∼85%) уровня дисферлина (18, 20), у них также наблюдается ряд других аномалий, не наблюдаемых у пациентов, в том числе крайняя восприимчивость к аутоиммунным заболеваниям, лимфоме, вирусным инфекциям и агрессивному поведению (21–24).В настоящее время неясно, связаны ли все эти аномалии с дефектом дисферлина. Следовательно, анализ функции дисферлина, основанный исключительно на исследованиях мышей SJL, может вводить в заблуждение.

Чтобы решить ранее упомянутые проблемы и изучить функцию дисферлина, мы получили две независимые линии мышей с дефицитом дисферлина с помощью (а) нацеливания генов и (б) генетического анализа инбредной линии мышей со вставкой ретротранспозона в ген дисферлина. У обеих линий мышей развилась прогрессирующая мышечная дистрофия с гистопатологическими и ультраструктурными особенностями, сходными с болезнью человека.Кроме того, две линии мышей различались по своему генетическому фону и по месту мутаций, что дает возможность оценить влияние этих двух факторов на фенотип заболевания мышц. В нашей стратегии нацеливания на гены мы случайно нацелились на тот же домен C2E, который мутировал у мышей SJL, чтобы нарушить функцию гена. Сравнительный анализ наших мышей и мышей SJL выявил как сходства, так и различия, подчеркнув возможность того, что на фоне SJL могут быть дополнительные поражения.Эти новые мышиные модели позволят проводить сравнительный анализ различных линий с дефицитом дисферлина и должны обеспечить более достоверную оценку функции дисферлина.

РЕЗУЛЬТАТЫ

Направленное разрушение дисферлина и создание Dysf

-/- мышей

Для создания нацеливающего вектора мы выделили контиг, включающий пять клонов ВАС, которые охватывают локус мышиного дисферлина. Человеческий и мышиный дисферлин имеют очень похожие аминокислотные последовательности (~90% идентичности), и предполагается, что оба они кодируют большой белок (>2000 аминокислот) с шестью предполагаемыми доменами C2 и одним трансмембранным сегментом на его С-конце (19).Чтобы инактивировать экспрессию гена дисферлина, мы заменили часть высококонсервативного домена C2E кассетой гена неомицина, расположенной в противоположной транскрипционной ориентации (рис. 1А). Вектор-мишень вводили в линию клеток J1 ES, и Саузерн-блот-анализ 197 G418 и колоний, устойчивых к ганцикловиру, выявил пять гомологичных рекомбинантных клонов. Три из этих клонов были использованы для создания химер, которые обеспечивали передачу по зародышевой линии. Мышей, гетерозиготных по дисферлину (Dysf +/- ), скрещивали для получения гомозиготных мутантов (Dysf -/- ) (фиг.1В), и все предсказанные генотипы были обнаружены в ожидаемых менделевских соотношениях, что указывает на отсутствие явных нарушений развития у мышей Dysf -/- .

Чтобы определить, приводит ли целевое разрушение к нулевому аллелю, для исследования экспрессии дисферлина использовали антитела к дисферлину, направленные против четырех различных эпитопов белка (Материалы и методы). В мышцах Dysf -/- не было обнаружено белка дисферлина, тогда как в мышцах Dysf +/- и дикого типа была видна заметная полоса 230 кДа (рис.1 С–Ф). Слабая полоса дисферлина также была обнаружена в мышце SJL, что согласуется с предыдущим сообщением о заметном снижении уровней дисферлина у этой линии мышей (18) (рис. 1C и D). Примечательно, что экспрессия дисферлина не изменилась у мышей mdx (мышиная модель мышечной дистрофии Дюшенна), что указывает на то, что потеря дистрофина не влияет на экспрессию дисферлина (рис. 1C). Мыши Dysf -/- имеют нормальный внешний вид и размер и неотличимы от однопометников дикого типа.Однако в возрасте 8 месяцев у некоторых мышей Dysf -/- развилось сжимание задних конечностей, и они больше не могли расправлять задние конечности и пальцы при подвешивании за хвост (данные не показаны). Это аномальное поведение, которое также наблюдалось у мышей SJL (18), указывает на то, что задние конечности были слабыми.

Выявление дефицита дисферлина у мышей A/J

Фенотип прогрессирующей мышечной дистрофии у мышей A/J был обнаружен в лаборатории Джексона (TJL) во время рутинного патологического исследования взрослых скелетных мышц в результате спонтанной черепно-лицевой мутации ( froggy ), возникшей на фоне инбредных A/J.Обследование однопометников с черепно-лицевым дефектом и без него показало, что у всех мышей из этой колонии была выражена патология мышечной дистрофии, характеризующаяся дегенерацией и регенерацией миофибрилл и центрально расположенных ядер. Мы расширили наше исследование, включив в него мышей A/J из производственных стад TJL, а также отдельные линии A/J исследователя, и наблюдали одинаковую гистопатологию дистрофических мышц у всех исследованных животных.

Сначала мы попытались картировать мутацию мышечной дистрофии A/J в рекомбинантных инбредных (RI) линиях мышей AXB и BXA, поскольку они произошли от предшественников A/J (A) и C57BL/6J (B) (25) и был генотипирован более чем по 700 локусам (26).Однако никаких признаков дистрофической гистопатологии не было обнаружено в срезах скелетных мышц от вышедших на пенсию производителей (два самца и две самки в возрасте 6–12 месяцев) в более чем 20 независимых линиях AXB и BXA RI. Мы также не обнаружили признаков дистрофической гистопатологии у двух дополнительных высокородственных инбредных линий мышей (A/WySnJ и A/HeJ), которые были отделены от L.C. Штамм-предшественник Стронга А в 1927 и 1938 годах соответственно (27). Это предполагает, что мутация мышечной дистрофии у мышей A/J возникла после создания линий AXB и BXA RI в 1975 г. и закрепилась в текущей колонии A/J в TJL.

Чтобы картировать локус мышечной дистрофии в A/J, мы провели полногеномное сканирование с 57 мышами N2 A/J×(A/J×B6), которое включало 32 больных и 25 здоровых мышей на основе уровней креатина в сыворотке. . Фенотип мышечной дистрофии A/J был нерекомбинантным в 57 мейозах с D6Mit8 , а порядок ближайших маркеров был, от центромеры к теломере, D6Mit188 -1,75±1,74 cM- D6Mit8 , A/J- дистрофия —5,26±2,96 сМ— D6Mit284. Dysferlin был выбран в качестве гена-кандидата для анализа, потому что мутация SJL- Dysf соответствует гену 1.Область 2 cM между D6Mit8 и D6Mit29 (18), и она полностью находилась в пределах нашего генетического интервала. Тест на аллелизм между A/J и SJL/J проводили путем создания (A/J×SJL/J) гибридов F1. Все гибридные мыши F1 имели гистопатологические признаки дегенерации и регенерации мышц (данные не показаны) и имели значительно повышенные уровни CK в сыворотке, что позволяет предположить, что две мутации были аллельными. Однако аллель A/J является уникальной мутацией и не является следствием генетической контаминации штаммом SJL, поскольку анализ RT-PCR в области, содержащей мутацию дисферлина SJL (18), амплифицирует только 500  п.н. дикого типа в A/ J скелетная и сердечная мышцы (данные не показаны).

Чтобы идентифицировать предполагаемую мутацию в гене Dysf , мы разработали праймеры для ПЦР для амплификации ~7,0  т.п.н. кДНК дисферлина из A/J и контрольной A/HeJ скелетной мышцы в 10 перекрывающихся фрагментах. Никаких мутаций не было выявлено ни в одном из фрагментов кДНК A/J по сравнению с контролем (данные не показаны). Для поиска мутации в геномной ДНК мышей A/J 5′-продукт ОТ-ПЦР, соответствующий нуклеотидам 89–580 мРНК Dysf мыши (номер доступа AF188290), использовали в качестве зонда на южном блот, содержащий ДНК из A/J, A/HeJ и A/WySnJ.Были идентифицированы измененные паттерны рестрикции Eco RI и Hin dIII, уникальные для геномной ДНК A/J (данные не показаны). Поиск в базе данных генома мыши Celera геномных фрагментов, секвенированных из A/J, DBA/2J и 129XI/SvJ, соответствующих последовательностям из Саузерн-блоттинга (экзоны 1–5), выявил уникальную вставку ретротранспозона ETn в интрон 4 в геномных фрагментах. производное от A/J (рис. 2A). Как 5′-, так и 3′-соединения вставки ETn присутствуют в базе данных и включают совершенную дупликацию 6  п.н. в месте вставки (номер доступа CeleraGA_x1PFAP6U11E и GA_x1PFAP640Q8 соответственно). Вставка ETn отсутствует в последовательностях DBA/2J или 129XI/SvJ из Celera или в общедоступной геномной последовательности мыши C57BL/6J (http://www.ensembl.org/Mus_musculus/). ПЦР-амплификация геномной ДНК через сайт встраивания давала фрагмент размером 207  п.н. в образцах A/HeJ, A/WySnJ и SJL/J, но постоянно терпела неудачу в образцах A/J из-за большого размера (5–6  т.п.н.) Вставка ETn (рис. 2 B). Было подтверждено, что последовательность ETn является уникальной для геномной ДНК A/J путем специфической амплификации соединения 3′ LTR/интрон 4, и в образцах A/HeJ, A/WySnJ или SJL/J не было обнаружено продукта амплификации (фиг.2 Б).

Чтобы оценить влияние вставки ETn на экспрессию дисферлина, мы провели нозерн- и вестерн-блоттинг. При использовании 3′-клона кДНК мышиного дисферлина (соответствующего аминокислоте 1993–2070) в качестве зонда транскрипт дисферлина ∼7,0  т.п.н. был обнаружен в мышечной РНК A/WySnJ и C57BL6/J, но не в A/J (рис. 2C). ). В соответствии с этим выводом вестерн-блот-анализ с использованием различных антител к дисферлину не выявил обнаруживаемого белка дисферлина у мышей A/J (рис. 2D и E), что указывает на то, что вставка ретротранспозона создала нулевой аллель.

У мышей с дефицитом дисферлина (Dysf

-/- и A/J) развивается прогрессирующая мышечная дистрофия

Чтобы определить, вызывает ли потеря дисферлина мышечную дистрофию, мы исследовали окрашенные гематоксилином и эозином (H&E) замороженные срезы различных мышц мышей Dysf -/- и однопометников дикого типа того же возраста. Самые ранние патологические признаки наблюдались у 2-месячных мышей Dysf -/- , которые состояли из рассеянных дегенерирующих и регенерирующих волокон с центрально расположенными ядрами (рис.3 Аа). Эти ранние дистрофические изменения были обнаружены в основном в проксимальных мышцах (четырехглавая мышца бедра и трехглавая мышца плеча), тогда как дистальные мышцы (икроножная, камбаловидная и передняя большеберцовая) не были затронуты (данные не представлены). Мышечная патология прогрессировала в зависимости от возраста. К 5-месячному возрасту отмечались выраженные изменения гистопатологии проксимальных мышц, характеризующиеся увеличением количества некротических и регенерирующих волокон, инфильтрацией мононуклеарных клеток в интактные волокна, фагоцитозом и выраженной вариабельностью размеров волокон (рис.3 аб). Кроме того, также были очевидны гипертрофированные волокна, расщепление волокон и замена жира. Важно отметить, что на этой стадии в дистальных мышцах наблюдались легкие миопатические признаки (данные не показаны), что указывает на постепенное распространение мышечного заболевания с возрастом. К 6-месячному возрасту отмечалась активная миопатия различной степени выраженности во всех исследованных скелетных мышцах. Четырехглавая мышца бедра и трехглавая мышца плеча были наиболее сильно пораженными мышцами, в то время как икроножная, камбаловидная и передняя большеберцовая мышцы имели умеренную гистопатологию даже на поздних стадиях заболевания (рис.3Бг и з). Неожиданно мы обнаружили, что мышцы живота поражены так же сильно, как и проксимальные мышцы (рис. 3 Bi). Напротив, диафрагма, двуглавая мышца плеча, жевательная и грудная мышцы были затронуты лишь незначительно (данные не представлены). Периваскулярные инфильтраты, эндомизиальный фиброз и воспаление наблюдались у 8-месячных мышей Dysf -/- , и они становились более распространенными с возрастом (рис. 3Ас). У мышей дикого типа и Dysf +/- не было признаков мышечной дистрофии в любом возрасте.

В параллельных исследованиях мышей SJL мы обнаружили, что возраст начала заболевания, участки гистопатологии мышц и прогрессирование заболевания мышц были аналогичны мышам Dysf -/- (данные не показаны). В отличие от мышей Dysf -/- и SJL, признаки дистрофии у мышей A/J проявлялись позже, примерно в возрасте 4–5 месяцев, и характеризовались легкой гистопатологией и более медленным прогрессированием мышечного заболевания (рис. 3). Объявление – f). Заметным исключением являются мышцы живота у мышей A/J, гистопатология которых аналогична таковой у мышей Dysf -/- того же возраста (рис.3 Бл). Несмотря на эти различия, распространение мышечного заболевания у мышей A/J было таким же, как у мышей SJL и Dysf -/- , с более тяжелым поражением проксимальных мышц, чем дистальных (рис. 3, Bj и k).

Потеря целостности сарколеммы у мышей с дефицитом дисферлина

Синий краситель Evans

(EBD) широко используется для демонстрации проницаемости мышечных волокон в различных моделях мышечных дистрофий у мышей (28, 29). EBD представляет собой индикатор с небольшой молекулярной массой, который прочно связывается с сывороточным альбумином.Конъюгат EBD-альбумин легко проникает в мышечные волокна с поврежденными клеточными мембранами, но не может проникать в здоровые мышцы. Чтобы оценить целостность сарколеммы мышц с дефицитом дисферлина, EBD вводили внутрибрюшинно мутантным мышам и мышам дикого типа для оценки поглощения красителя. У контрольных мышей и мышей Dysf +/- окрашивание EBD не было обнаружено ни макроскопически, ни микроскопически (рис. 4 A и B). Напротив, окрашивание EBD наблюдалось у Dysf -/- , SJL и в меньшей степени у мышей A/J, и они появлялись в основном в четырехглавой мышце бедра, трехглавой мышце плеча, приводящих мышцах ноги и мышцах живота.В частности, поглощение EBD приводящими мышцами и мышцами живота приводило к поразительному паттерну полос, который не наблюдался в мышцах дикого типа (рис. 4C). Интересно, что этот тип паттерна полос также наблюдался в мышцах диафрагмы мышей, лишенных γ-саркогликана (30) или кавеолина-3 (31). При просмотре под флуоресцентным микроскопом волокна, окрашенные EBD, демонстрировали красную флуоресценцию (рис. 4D), и эти волокна обычно обнаруживались некротизированными или гипертрофированными при окрашивании H&E.

Мы также определили уровни КК в сыворотке для оценки целостности сарколеммы.Уровни CK в сыворотке 4-недельных мышей Dysf -/- , A/J и SJL были в 4-6 раз выше, чем в контрольной группе (рис. 4E), что является дополнительным свидетельством повреждения мышечной мембраны у мышей с дисферлином. дефицитные мыши.

Экспрессия дистрофина и связанных с ним белков в мышцах с дефицитом дисферлина

Мутации в дистрофине и связанных с ним белках связаны с несколькими формами мышечной дистрофии (2). Чтобы определить, изменяет ли потеря дисферлина экспрессию дистрофина и связанных с ним белков, мы исследовали эти белки в мышцах с дефицитом дисферлина с помощью иммунофлуоресцентного анализа и вестерн-блоттинга.Вопреки предыдущим сообщениям (17, 32), мы обнаружили, что дисферлин был локализован в сарколемме в мышцах дикого типа, и не было доказательств экспрессии дисферлина в цитоплазматических везикулах (рис. 5А). Мы получили тот же результат, используя различные антитела к дисферлину (NCL-Hamlet, Sal-I и C-19), и наши результаты согласуются с отчетами других лабораторий (8, 9, 33–35).

Несмотря на отсутствие дисферлина в сарколемме мышей Dysf -/- , A/J и SJL, экспрессия и распределение дистрофина и β-саркогликана не изменялись (рис.5 А). Точно так же экспрессия и распределение саркоспана, α-, δ- и γ-саркогликанов также не изменялись при потере дисферлина (данные не показаны). В соответствии с этими выводами иммуноблот-анализ показал, что уровни дистрофина, β-дистрогликана, дистробревина, α-саркогликана, тельтонина и nNOS не изменились у мышей с дефицитом дисферлина (рис. 5B).

Экспрессия кавеолина-3 и кальпаина-3 в мышцах с дефицитом дисферлина

Кавеолин-3 представляет собой мышечно-специфический мембранный белок, который важен для формирования мембран кавеол, выступая в качестве каркаса для организации и концентрации взаимодействующих с кавеолином липидов и белков (36).Сообщалось, что кавеолин-3 взаимодействует с дисферлином на основании исследований ко-иммунопреципитации и обнаружения сниженной экспрессии кавеолина-3 у некоторых пациентов с дисферлинопатией с помощью иммунофлуоресцентного анализа и вестерн-блоттинга (37, 38). Мы не обнаружили признаков измененной экспрессии или распределения кавеолина-3 в мышцах Dysf -/- , SJL и A/J (рис. 5A). Точно так же иммуноблот-анализ показал нормальные уровни белка кавеолина-3 в мышцах с дефицитом дисферлина по сравнению с контролем (рис.5 Б). Кальпаин-3, мышечно-специфическая активируемая кальцием протеаза, также предположительно связана с дисферлином, поскольку ее уровни были снижены у половины исследованных пациентов с LGMD 2B (39). Однако наш иммуноблот-анализ показал нормальные уровни кальпаина-3 у мышей Dysf -/- , SJL и A/J по сравнению с контролем (фиг. 5B).

Ультраструктурный анализ мышцы с дефицитом дисферлина

Чтобы дополнительно охарактеризовать аномалии мышечной мембраны, выявленные окрашиванием EBD, мы исследовали ультраструктурные особенности мышц с дефицитом дисферлина у мышей Dysf -/- , A/J и SJL.Наиболее заметным и постоянным признаком, обнаруженным у всех трех линий мышей, было заметное утолщение и фокальное удвоение базальной пластинки (рис. 6 B и C). Кроме того, были отдельные участки разрыва мембраны (рис. 6В) и скопления везикул вблизи сарколеммы (рис. 6Б). Сократительный аппарат, тонкие и толстые филаменты и нервно-мышечные соединения оказались нормальными у мышей с дефицитом дисферлина.

Поведенческие различия между разными линиями мышей с дефицитом дисферлина

В нашей колонии мышей SJL мы постоянно замечали серьезные укушенные раны у самок мышей, спаривавшихся с самцами SJL.Кроме того, однопометников мужского пола приходилось разлучать примерно в 8-недельном возрасте, чтобы предотвратить серьезные травмы в результате драки. Это чрезвычайно агрессивное поведение мышей SJL хорошо известно (24), но поразительно, что ни мыши Dysf -/- , ни мыши A/J не проявляли сходных агрессивных черт. На самом деле известно, что мыши A/J чрезвычайно неагрессивны и использовались для идентификации локусов количественных признаков агрессии (40, 41). Поскольку во всех трех линиях мышей отсутствовал дисферлин, маловероятно, что агрессивное поведение мышей SJL связано с дефицитом дисферлина.Эти наблюдения предполагают, что в штамме SJL могут быть дополнительные генетические дефекты или что существует уникальная комбинация аллелей в фоне SJL, объясняющая агрессивное поведение.

ОБСУЖДЕНИЕ

Мышиные модели мышечных дистрофий человека предоставили ценную информацию для нашего понимания патогенетического механизма мышечных заболеваний (42). В этом исследовании мы сообщаем о двух новых линиях мышей с дефицитом дисферлина в качестве моделей дисферлинопатии.Две линии мышей были получены путем (а) направленной инактивации гена и (б) идентификации спонтанной мутации в гене дисферлина у мышей A/J. Обе линии мышей развили прогрессирующую мышечную дистрофию и повторили клинические и гистопатологические признаки болезни человека, включая повышенные уровни СК в сыворотке, дегенерацию и регенерацию миофибрилл, внутренние миоядра, изменение размера волокон, эндомизиальный фиброз, замещение жира и воспаление мышц.

У мышей A/J и Dysf -/- в начале развилась дегенерация проксимальных мышц, несмотря на различия в их генетическом фоне и месте их мутации.Вставка ретротранспозона у мышей A/J происходила вблизи 5′-конца (интрон 4) гена дисферлина, тогда как целевое нарушение происходило на 3′-конце (экзон 45). Следовательно, как и у пациентов с дефицитом дисферлина, не было очевидной корреляции между местом мутации и распространением мышечного заболевания в животных моделях дисферлинопатии. Эти данные подтверждают гипотезу о том, что в формирование паттерна мышечной дегенерации при дисферлинопатии могут быть вовлечены дополнительные факторы (3, 7).

Две линии мышей с дефицитом дисферлина также продемонстрировали дивергенцию фенотипа, сходную с клинической гетерогенностью, наблюдаемой у пациентов. В частности, мыши A/J продемонстрировали более поздний возраст начала и более медленное прогрессирование заболевания мышц по сравнению с мышами Dysf -/- . Поскольку в обеих линиях мышей отсутствует дисферлин, различия в типе генетического повреждения или месте мутации вряд ли объясняют более мягкий фенотип A/J. На вариант фенотипа мышечного заболевания у мышей A/J и Dysf -/- , скорее всего, повлияли различия в их генетическом фоне.Следовательно, мыши A/J должны быть ценным ресурсом для картирования и идентификации генов, которые могут задерживать начало или прогрессирование мышечного заболевания. Идентификация этих генов-модификаторов может предоставить дополнительные мишени для терапевтического вмешательства.

Потеря целостности сарколеммы является характерным признаком нескольких форм мышечных дистрофий и играет важную роль в патогенезе дегенерации и некроза мышечных клеток (29). Мы исследовали, связана ли дисферлинопатия с дефектами мембран, путем витального окрашивания с помощью EBD и оценки уровней CK в сыворотке.Мы обнаружили повышенные уровни CK в сыворотке и внутриклеточное поглощение EBD в мышцах с дефицитом дисферлина, что указывает на потерю целостности сарколеммы. Дополнительные доказательства в пользу повреждения мембран при дисферлинопатии были получены при ультраструктурном анализе мышц с дефицитом дисферлина, который выявил заметное утолщение базальной пластинки, изолированные области разрыва мембраны и скопление везикул вблизи сарколеммы. Эти результаты аналогичны дефектам мембран, выявленным у пациентов с дисферлинопатией (43).

Избыточные везикулы, наблюдаемые в мышцах с дефицитом дисферлина, напоминают мутантный фенотип fer-1 у Caenorhabditis elegans , ортолога дисферлина, экспрессируемого в больших везикулах сперматид. У мутантов fer-1 большие везикулы не смогли слиться с плазматической мембраной и остались в цитоплазме, что указывает на то, что fer-1 необходим для обеспечения процесса слияния (11). По аналогии, утолщенная базальная пластинка и избыток везикул, наблюдаемые в мышцах с дефицитом дисферлина, могут отражать безуспешные попытки мутантных мышечных клеток повторно запечатать свои разрушенные мембраны.На основании этих наблюдений и его гомологии с fer-1 , дисферлин может функционировать при восстановлении мышечной мембраны, используя некоторые из своих доменов C2 в качестве сенсоров для мониторинга внутриклеточной концентрации кальция и для обеспечения слияния цитоплазматических везикул с участками разрушенной мембраны для повторное уплотнение при аномальном притоке ионов кальция. Такая роль дисферлина подтверждается недавними данными о переносе кальция и обнаружением мембранных бляшек на поврежденных участках мышечных волокон дикого типа (17, 44).

Мышечная патология у мышей с дефицитом дисферлина, по-видимому, не является результатом вторичных изменений дистрофина или компонентов комплекса дистрофин-гликопротеин (DGC). Концентрация несарколемных белков, nNOS и кальпаина 3 также не изменялась в мышцах с дефицитом дисферлина. Эти результаты согласуются с исследованиями белков мышц у пациентов с дисферлинопатией и подтверждают, что дисферлин не является неотъемлемым компонентом DGC (8, 35). Интактный DGC и нормальная экспрессия известных мышечных белков указывают на то, что дефекты мембран и дегенерация миофибрилл при дисферлинопатиях были непосредственно опосредованы потерей дисферлина посредством нового патогенетического механизма при мышечных дистрофиях.

В нашей стратегии нокаута гена мы выбрали экзон 45 для целенаправленного разрушения, поскольку он кодирует часть высококонсервативного домена C2E, и предполагается, что делеция этого экзона отменит функцию дисферлина. Доказательства того, что экзон 45 важен для функции дисферлина, подтверждаются недавними исследованиями мутаций, которые идентифицировали пять различных мутаций в этом экзоне. Две мутации представляют собой миссенс-изменения в кодирующей последовательности (6, 38), тогда как остальные мутации находятся в 3′-конце сплайсинга (4, 45, 46).Между прочим, мутация у мышей SJL также локализована в 3′-конце сплайсинга экзона 45 (19). Все ранее упомянутые мутации приводят либо к заметному уменьшению, либо к полной потере дисферлина. Примечательно, что остаточного количества дисферлина (<50%) недостаточно для предотвращения возникновения или изменения тяжести мышечного заболевания у людей (8, 45) или у мышей (18).

Хотя мыши SJL и Dysf -/- имеют мутации в одном и том же экзоне и демонстрируют схожую гистопатологию мышц, они также обнаруживают заметные фенотипические различия.Наиболее яркое различие между этими двумя линиями мышей заключается в агрессивном поведении мышей SJL, что требовало индивидуального содержания этих животных. Напротив, мыши Dysf -/- и A/J демонстрируют низкую внутрилинейную агрессию (41). Мыши SJL также чрезвычайно восприимчивы к аутоиммунным заболеваниям и широко используются в качестве модели для изучения экспериментального аллергического энцефалита (47) и воспалительных миопатий (21). Примечательно, что мыши SJL также широко используются в качестве модели для изучения иммунобиологии опухолей из-за высокой частоты В-клеточных лимфом у этой линии (22, 24).В настоящее время неясно, связаны ли все эти разнообразные фенотипы с дефицитом дисферлина, но поразительно, что эти фенотипы не наблюдались у мышей Dysf -/- или A/J. Поскольку SJL является инбредным штаммом, в этом штамме могут быть дополнительные генетические повреждения, объясняющие разнообразие фенотипов. Эта гипотеза подтверждается открытием, что в дополнение к дефекту дисферлина, мыши SJL также гомозиготны по мутации дегенерации сетчатки 1 (Pde6b rd1 ), которая вызывает слепоту к возрасту отнятия от груди (48).Также возможно, что дивергентные фенотипы у мышей SJL обусловлены не дополнительными мутациями в линии, а уникальной комбинацией аллелей в ее генетическом фоне. В таблице 1 приведены характерные особенности трех линий мышей с дефицитом дисферлина.

Штамм мышей A/J является одним из наиболее широко используемых штаммов в исследованиях рака и иммунологии (27). Он широко используется в качестве модели для изучения рака легких из-за высокой частоты спонтанных и химически индуцированных аденом легких у этого штамма (49).Что еще более важно, инбредные штаммы A/J и C57BL/6J по-разному восприимчивы к более чем 30 признакам и заболеваниям, включая старение, поведение, рак легких, инфекционные заболевания, иммунологические реакции и сложные заболевания, такие как диабет и ожирение (50, 51). ). Из-за множества фенотипических различий между этими двумя штаммами их использовали для конструирования (i) штаммов RI, AXB и BXA (25), (ii) рекомбинантных конгенных штаммов, AcB и BcA (50) и (iii) хромосомных замен. штаммы, B6.A (52, 53), в качестве инструментов для изучения генетической основы межштаммовых различий при спонтанных или экспериментально индуцированных заболеваниях. В дополнение к ранее упомянутым линиям, мышей A/J также использовали для получения штамма SMXA RI от реципрокных скрещиваний между родительскими линиями SM/J и A/J (54).

Учитывая широкое использование линии мышей A/J, некоторые или все ранее упомянутые линии, происходящие от A/J, могут нести дефект дисферлина. Мы определили, что штаммы AXB и BXA RI, полученные в 1975 г., не несут мутации A/J.Напротив, ПЦР-анализ ДНК штамма B6.A-хромосома 6 с замещенными хромосомами показал, что он несет мутацию A/J (данные не показаны). Поскольку B6.A был сконструирован в начале 1990-х годов, эти данные позволяют предположить, что мутация в штамме A/J должна была произойти между концом 1970-х и началом 1980-х годов и закрепиться в производственном племенном поголовье. Эти результаты также свидетельствуют о том, что мышь A/J может больше не подходить в качестве родительского контроля для штаммов AXB и BXA RI, поскольку последние не имеют мутации A/J.Предполагается, что рекомбинантные конгенные штаммы AcB и BcA несут мутацию A/J, поскольку они были сконструированы в середине 1990-х годов. Следовательно, все исследования с участием мышей A/J или мышей, происходящих от A/J, должны учитывать дефект дисферлина у этих линий, особенно для исследований, оценивающих двигательную активность и координацию у этих мышей (55).

Таким образом, мы получили и охарактеризовали две независимые линии мышей с дефицитом дисферлина, черты которых очень напоминают человеческое заболевание дисферлинопатии.Эти мыши, наряду с SJL, должны быть полезными моделями для исследования патогенного пути, лежащего в основе дисферлинопатии, и для разработки новых терапевтических стратегий. Кроме того, сравнительный генетический анализ различных линий мышей с дефицитом дисферлина должен помочь подтвердить фенотипы, связанные с дефицитом дисферлина, и идентифицировать гены-модификаторы, которые могут задерживать начало или прогрессирование мышечного заболевания.

МАТЕРИАЛЫ И МЕТОДЫ

Построение вектора наведения

Ген дисферлина мыши был выделен из библиотеки 129/SvJ BAC (Research Genetics) путем гибридизационного скрининга с зондами кДНК дисферлина человека, соответствующими различным областям DYSF. Пять перекрывающихся клонов ВАС, которые включали ген дисферлина, были установлены с помощью рестрикционного картирования, частичного секвенирования и Саузерн-блоттинга. Фрагмент RI Eco размером 11  т.п.н., соответствующий экзонам 42–46 гена дисферлина человека , субклонировали из 3′-ВАС-клона. Из этого субклона фрагмент Stu I / Kpn I размером 2,6 т.п.н., расположенный проксимальнее экзона 45, и фрагмент Sal I / Eco RI размером 6,0 т.п.н., дистальный относительно экзона 45, клонировали в положительно-отрицательный селекционный вектор pKO ( Стратагена) (рис.1).

Поколение Dysf

-/- мышей

Линеаризованный нацеливающий вектор Not I вводили в линию клеток J1 ES с помощью электропорации, и колонии, выжившие после отбора G418 и ганцикловира, выделяли, размножали и подвергали скринингу с помощью Саузерн-блоттинга. ES-клетки из трех правильно нацеленных клонов микроинъецировали в бластоцисты C57BL/6J и переносили псевдобеременным реципиентам. Химерных самцов скрещивали с самками C57BL/6J для получения гетерозиготного потомства на смешанном фоне 129SvJ и C57BL/6J.Передачу по зародышевой линии оценивали по цвету шерсти и подтверждали Саузерн-блоттингом ДНК хвоста (рис. 1). Гетерозиготных мышей скрещивали для получения гомозиготных мышей на смешанном фоне. Со всеми животными в этом исследовании обращались и лечили в соответствии с протоколом, одобренным подкомитетом Massachusetts General Hospital по уходу за исследовательскими животными.

Нозерн-блот и вестерн-блоттинг

Тотальную РНК выделяли из скелетных мышц с использованием набора RNAeasy (Qiagen) в соответствии с инструкциями производителя.15 мкг общей РНК фракционировали на 1,2% агарозном геле, содержащем 5% формальдегида, блотировали на мембране Hybond-N (Amersham) и гибридизовали с зондом кДНК дисферлина мыши, соответствующим аминокислоте 1993–2070.

Для анализа белка мышиные ткани гомогенизировали в 20 объемах буфера для экстракции тканей T-PER (Pierce, Rockford, IL, USA) и кипятили в течение 5 мин. После центрифугирования при 14 000 g в течение 10 мин содержание белка в супернатанте определяли с использованием реагента для анализа белка Кумасси (Pierce).Иммуноблоттинг проводили, как описано ранее (10).

Антитела

Ранее были описаны моноклональные антитела NCL-Hamlet (Novacastra Laboratories, Ньюкасл-апон-Тайн, Великобритания) и аффинно-очищенные кроличьи поликлональные антитела (Sal-1) против дисферлина (8, 9). Кроме того, козьи поликлональные антитела против дисферлина, C-19, были приобретены у Santa Cruz Biotechnology (Сан-Диего, Калифорния, США), а кроличьи поликлональные антитела, HM38, были получены против синтетических пептидов, соответствующих карбоксильному концу человеческого дисферлина ( аминокислота 2071–2080).Моноклональные антитела против дистрофина (NCL-DYS), α-саркогликана (NCL-a-SARC), β-саркогликана (NCL-b-SARC), β-дистрогликана (NCL-b-DG) и кальпаина-3 (NCL-CALP) -12A) были приобретены у Novacastra Laboratories для вестерн-блоттинга. Кроличьи поликлональные антитела против телетонина и нейронального оксида азота были приобретены у Santa Cruz Biotechnology Inc, а кавеолин-3 у Transduction Laboratories (Лексингтон, Кентукки, США).

Гистологический и иммунофлуоресцентный анализ

Гистологический и иммуногистохимический анализы скелетных мышц проводили на нефиксированных тканях, замороженных в изопентане, охлаждаемом жидким азотом.Поперечные срезы различных мышц толщиной 8–10 мкм окрашивали гематоксилином и эозином (H&E) для гистопатологического анализа. Иммунофлуоресцентный анализ проводили с использованием специфических кроличьих поликлональных антител, как описано ранее (56).

Витальное окрашивание с помощью EBD и анализа CK в сыворотке

Для оценки целостности мембраны мышечных клеток мышам внутрибрюшинно вводили EBD (10 мг/мл в фосфатно-солевом буфере) (0,1 мл/10 г массы тела), как описано ранее (28).Мышей забивали через 12–16  часов после инъекции, делали срезы их мышц и исследовали под флуоресцентным микроскопом на поглощение красителя.

Для измерения КФК образцы крови собирали из ретроорбитального синуса с помощью гепаринизированных капиллярных трубок у 4-недельных мышей. Образцы плазмы, полученные путем центрифугирования при 2000 g , анализировали по отдельности с помощью химического анализатора Beckman Synchron 5 с использованием реагентов, предоставленных производителем. В целях фенотипирования мышей в скрещивании A/J×(A/J×B6) N2 пороговое значение СК, равное 200  МЕ/л, использовалось для обозначения пораженных мышей.

Мыши

Поголовье мышей A/J, A/HeJ, A/WySnJ, B6.A- Tyr + , C57BL/6J, SJL/J, AXB и BXA RI разводили и содержали в стандартных условиях в Исследовательском Приют для животных в TJL. Их содержали на пище с содержанием жира 6% NIH и подкисленной воде с циклом темноты 12 : 12 ч темно : света и в обычных помещениях, которые регулярно контролируются для поддержания среды, свободной от конкретных патогенов. Процедуры, используемые в экспериментах, были одобрены Институциональным комитетом по уходу и использованию животных.

Генетическое картирование

ДНК

, выделенная из скрещивания 57 N2 A/J× (A/J×B6), подвергали полногеномному сканированию, в котором использовали ~80 надежных полиморфных маркеров с простой последовательностью, о которых известно, что они различаются между B6 и A/J. Как только вероятное положение на карте было идентифицировано на хромосоме 6, были протестированы дополнительные маркеры вокруг локусов, которые показали значительный перекос аллелей, чтобы подтвердить сцепление. Для ПЦР-амплификации использовали 25 нг ДНК в объеме 15 мкл, содержащем 50 мМ KCl, 10 мМ Трис-Cl, pH 8.3, 2,0 мМ MgCl 2 , 0,2 мкМ олигонуклеотидов, по 200 мкМ каждого dNTP и 0,02 ед. ДНК-полимеразы AmpliTaq. Реакции, которые первоначально денатурировали в течение 2 мин при 95°C, подвергали 35 циклам по 10 с при 95°C, 15 с при 55°C, 30 с при 72°C и 2 минутному удлинению при 72°C. Продукты ПЦР разделяли электрофорезом на 4% агарозном геле MetaPhor (FMC, ME) и визуализировали в УФ-свете после окрашивания бромистым этидием.

ОТ-ПЦР-анализ

Тотальную РНК выделяли из скелетных мышц мышей A/J, A/HeJ, A/WySnJ и SJL/J с помощью тризольного метода (Gibco BRL Life Technologies, Rockville, MD, USA) в соответствии с инструкциями производителя.Для ОТ-ПЦР-анализа дисферлина 5 мкг общей РНК каждого штамма обрабатывали ДНКазой и подвергали обратной транскрипции с использованием случайных гексамеров и олиго-dT, как описано ранее (57). Полученные продукты ПЦР разделяли на 1% агарозных гелях, полосы вырезали и очищали на геле для клонирования и секвенирования с использованием процедуры QIAEX II (Qiagen).

Праймеры для обнаружения мутаций

Праймерами для обнаружения мутации у мышей A/J были: dysf-F (A/J-F), TTCTCTCTTGTCGGTCCTAG; Dysf-R (A/J-R), CTTCACTGGGAAGTATGTCG; ETn-oR (3′ LTR), GCCTTGATCAGAGTAACTGTC и ETn-R2 (5′ LTR), ACGAAGATCCTTTCCTGTGG.

БЛАГОДАРНОСТИ

Мы благодарим г-жу Siok-Yuen Kam за прекрасную техническую помощь и доктора B. Hosler за полезные комментарии к этой рукописи. Работа выполнена при поддержке Ассоциации мышечной дистрофии (США) и инвестиционной компании Cecil B. Day.

Рисунок 1. Получение мышей с дефицитом дисферлина путем нацеливания генов. ( A ) Рестрикционная карта локуса дисферлина дикого типа вокруг экзона 45 (вверху), вектора-мишени (в центре) и предсказанный размер фрагментов Sph I из аллелей дикого типа и рекомбинантных аллелей (внизу).Область размером 1,8  т.п.н., охватывающая экзон 45, была делетирована и заменена кассетой промотора фосфоглицераткиназы-неомицина (PGK-neo), расположенной в противоположном направлении транскрипции. Указан зонд, используемый в Саузерн-блот-анализе для генотипирования ES-клеток и мышей. Е, Эко РИ; С, Сф Я; У, Стю И; К, Кпн И; L, Sal I. ( B ) Саузерн-блот-анализ Sph I расщепленной геномной ДНК из образцов биопсии хвоста.Замена экзона 45 на кассету PGK-neo вводит новый сайт Sph I в рекомбинантный аллель, который дает фрагмент размером 3,5 т.п.н. по сравнению с фрагментом 8,3 т.п.н. из аллеля дикого типа. +/+, дикий тип; +/-, гетерозиготный мутант; -/-, гомозиготный мутант. ( C F ) Иммуноблот-анализ гомогенатов скелетных мышц дикого типа (дорожка 1), гетерозиготного мутанта (дорожка 2), гомозиготного мутанта (дорожка 3), SJL (дорожка 4) и mdx (дорожка 5) мышей с использованием следующих антител против дисферлина: Sal-1 (C), NCL-Hamlet (D), C-19 (E) и HM38 (F).Белок дисферлин с молекулярной массой 237 кДа был обнаружен у мышей дикого типа, гетерозиготных и mdx, но не у гомозиготных мутантных мышей. Следовые количества дисферлина также были обнаружены у мышей SJL.

Рис. 1. Получение мышей с дефицитом дисферлина путем нацеливания генов. ( A ) Рестрикционная карта локуса дисферлина дикого типа вокруг экзона 45 (вверху), вектора-мишени (в центре) и предсказанный размер фрагментов Sph I из аллелей дикого типа и рекомбинантных аллелей (внизу).Область размером 1,8  т.п.н., охватывающая экзон 45, была делетирована и заменена кассетой промотора фосфоглицераткиназы-неомицина (PGK-neo), расположенной в противоположном направлении транскрипции. Указан зонд, используемый в Саузерн-блот-анализе для генотипирования ES-клеток и мышей. Е, Эко РИ; С, Сф Я; У, Стю И; К, Кпн И; L, Sal I. ( B ) Саузерн-блот-анализ Sph I расщепленной геномной ДНК из образцов биопсии хвоста.Замена экзона 45 на кассету PGK-neo вводит новый сайт Sph I в рекомбинантный аллель, который дает фрагмент размером 3,5 т.п.н. по сравнению с фрагментом 8,3 т.п.н. из аллеля дикого типа. +/+, дикий тип; +/-, гетерозиготный мутант; -/-, гомозиготный мутант. ( C F ) Иммуноблот-анализ гомогенатов скелетных мышц дикого типа (дорожка 1), гетерозиготного мутанта (дорожка 2), гомозиготного мутанта (дорожка 3), SJL (дорожка 4) и mdx (дорожка 5) мышей с использованием следующих антител против дисферлина: Sal-1 (C), NCL-Hamlet (D), C-19 (E) и HM38 (F).Белок дисферлин с молекулярной массой 237 кДа был обнаружен у мышей дикого типа, гетерозиготных и mdx, но не у гомозиготных мутантных мышей. Следовые количества дисферлина также были обнаружены у мышей SJL.

Рисунок 2. Идентификация дефекта дисферлина у мышей A/J. ( A ) Схематическое изображение вставки ретротранспозона (ETn) в локусе дисферлина у мышей A/J. Вставка ETn произошла в интроне 4 и вызвала аберрантный сплайсинг гена дисферлина.( B ) ПЦР-анализ геномной ДНК, выделенной из мышей A/J (A), A/HeJ (H), A/WySnJ (W) и SJL (S), с использованием указанных пар праймеров. Используя пару праймеров, фланкирующих вставку ETn (F+R), продукт размером 207  п.н. был получен от всех мышей, кроме A/J. И наоборот, только геномная ДНК мышей A/J генерировала продукт ПЦР при использовании праймеров, специфичных для последовательностей ETn. ( C ) Нозерн-блоттинг тотальной РНК, выделенной из скелетных мышц A/WySnJ (дорожка 1), A/J (дорожка 2) и C57BL6/J (дорожка 3).Используя 3′-кДНК мышиного дисферлина в качестве зонда, транскрипт дисферлина ~7,0  т.п.н. был обнаружен у мышей A/WySnJ и C57BL6/J, но не у мышей A/J. Тот же самый блот гибридизовали с кДНК актина, чтобы показать равную загрузку. ( D , E ) Иммуноблот-анализ экспрессии дисферлина в экстрактах скелетных мышц из C57BL6/J (дорожка 1), A/WySnJ (дорожка 2), A/J (дорожка 3), SWR/J (дорожка 4) и 129/SvJ (дорожка 5). Используя аффинно-очищенные козьи поликлональные антитела C-19 (D) или моноклональные антитела NCL-Hamlet (E), белок дисферлин был обнаружен у всех исследованных инбредных мышей, кроме A/J.

Рис. 2. Идентификация дефекта дисферлина у мышей A/J. ( A ) Схематическое изображение вставки ретротранспозона (ETn) в локусе дисферлина у мышей A/J. Вставка ETn произошла в интроне 4 и вызвала аберрантный сплайсинг гена дисферлина. ( B ) ПЦР-анализ геномной ДНК, выделенной из мышей A/J (A), A/HeJ (H), A/WySnJ (W) и SJL (S), с использованием указанных пар праймеров. Используя пару праймеров, фланкирующих вставку ETn (F+R), продукт размером 207  п.н. был получен от всех мышей, кроме A/J.И наоборот, только геномная ДНК мышей A/J генерировала продукт ПЦР при использовании праймеров, специфичных для последовательностей ETn. ( C ) Нозерн-блоттинг тотальной РНК, выделенной из скелетных мышц A/WySnJ (дорожка 1), A/J (дорожка 2) и C57BL6/J (дорожка 3). Используя 3′-кДНК мышиного дисферлина в качестве зонда, транскрипт дисферлина ~7,0  т.п.н. был обнаружен у мышей A/WySnJ и C57BL6/J, но не у мышей A/J. Тот же самый блот гибридизовали с кДНК актина, чтобы показать равную загрузку. ( D , E ) Иммуноблот-анализ экспрессии дисферлина в экстрактах скелетных мышц из C57BL6/J (дорожка 1), A/WySnJ (дорожка 2), A/J (дорожка 3), SWR/J (дорожка 4) и 129/SvJ (дорожка 5).Используя аффинно-очищенные козьи поликлональные антитела C-19 (D) или моноклональные антитела NCL-Hamlet (E), белок дисферлин был обнаружен у всех исследованных инбредных мышей, кроме A/J.

Рис. 3. Гистологический анализ окрашенных H&E мышц мышей Dysf -/- и A/J. ( A ) Сравнительный анализ четырехглавой мышцы бедра у 2-месячных, 5-месячных и 14-месячных Dysf -/- (a, b, c) и A/J (d, e, f) ) мышей.У обеих линий мышей развилась прогрессирующая мышечная дистрофия, но они различаются по степени тяжести и прогрессированию. ( а ) Ранние дистрофические признаки у 2-месячных мышей Dysf -/- состоят из рассеянных некротических волокон (в центре, бледное окрашивание) и некоторых волокон с центрально расположенными ядрами. (b) Мышцы 5-месячных мышей демонстрируют выраженные гистопатологические изменения, которые включают повышенный некроз и регенерированные волокна, инфильтрацию мононуклеарных клеток, фагоцитоз, гипертрофические волокна, расщепление волокон и замещение жира (внизу, белые области).(c) По мере прогрессирования заболевания наблюдался обширный эндомизиальный фиброз, замещение жира и периваскулярные инфильтраты. ( d – f ) Четырехглавые мышцы мышей A / J демонстрируют менее серьезную гистопатологию мышц по сравнению с мышами Dysf -/- того же возраста. Самый ранний дистрофический признак наблюдался у 5-месячных мышей A/J, включающий несколько мышечных волокон с центрально расположенными ядрами (e). Гистопатология мышц 14-месячных мышей A/J (f) напоминает таковую у 9-месячных мышей Dysf -/- (g), что указывает на более медленное прогрессирование мышечного заболевания у A/J по сравнению с Dysf -/- .( B ) Анализ распределения гистопатологии мышц у 9-месячных мышей Dysf -/- (g, h, i) и 11-месячных мышей A/J (j, k, l). Обе линии мышей показали сходное распределение мышечного заболевания, при этом четырехглавая мышца (проксимальная) была поражена сильнее, чем икроножная (дистальная). Неожиданно оказалось, что гистопатология мышц живота у мышей A/J аналогична таковой у мышей Dysf -/- . Масштабная линейка: (c, i, l) 100 мкм, все остальные цифры 50 мкм.

Рис. 3. Гистологический анализ окрашенных H&E мышц мышей Dysf -/- и A/J. ( A ) Сравнительный анализ четырехглавой мышцы бедра у 2-месячных, 5-месячных и 14-месячных Dysf -/- (a, b, c) и A/J (d, e, f) ) мышей. У обеих линий мышей развилась прогрессирующая мышечная дистрофия, но они различаются по степени тяжести и прогрессированию. ( а ) Ранние дистрофические признаки у 2-месячных мышей Dysf -/- состоят из рассеянных некротических волокон (в центре, бледное окрашивание) и некоторых волокон с центрально расположенными ядрами.(b) Мышцы 5-месячных мышей демонстрируют выраженные гистопатологические изменения, которые включают повышенный некроз и регенерированные волокна, инфильтрацию мононуклеарных клеток, фагоцитоз, гипертрофические волокна, расщепление волокон и замещение жира (внизу, белые области). (c) По мере прогрессирования заболевания наблюдался обширный эндомизиальный фиброз, замещение жира и периваскулярные инфильтраты. ( d – f ) Четырехглавые мышцы мышей A / J демонстрируют менее серьезную гистопатологию мышц по сравнению с мышами Dysf -/- того же возраста.Самый ранний дистрофический признак наблюдался у 5-месячных мышей A/J, включающий несколько мышечных волокон с центрально расположенными ядрами (e). Гистопатология мышц 14-месячных мышей A/J (f) напоминает таковую у 9-месячных мышей Dysf -/- (g), что указывает на более медленное прогрессирование мышечного заболевания у A/J по сравнению с Dysf -/- . ( B ) Анализ распределения гистопатологии мышц у 9-месячных мышей Dysf -/- (g, h, i) и 11-месячных мышей A/J (j, k, l).Обе линии мышей показали сходное распределение мышечного заболевания, при этом четырехглавая мышца (проксимальная) была поражена сильнее, чем икроножная (дистальная). Неожиданно оказалось, что гистопатология мышц живота у мышей A/J аналогична таковой у мышей Dysf -/- . Масштабная линейка: (c, i, l) 100 мкм, все остальные цифры 50 мкм.

Рис. 4. Оценка целостности сарколеммы путем витального окрашивания с помощью EBD и уровней CK в сыворотке. Мышам дикого типа и мышам с дефицитом дисферлина внутрибрюшинно вводили EBD, и оценивали поглощение красителя различными мышцами.Макроскопическое исследование мышц живота 20-недельных мышей дикого типа ( A ) и мышей Dysf -/- ( C ) выявило заметное включение EBD в мышцы с дефицитом дисферлина, но не в мышцы дикого типа. (+/+). С помощью флуоресцентной микроскопии мышечные волокна, содержащие EBD, показывают красное цитоплазматическое окрашивание. При микроскопическом анализе не было доказательств поглощения красителя четырехглавой мышцей дикого типа ( B ), но накопление EBD наблюдалось в четырехглавой мышце с дефицитом дисферлина ( D ).( E ) Уровни СК в сыворотке инбредных мышей и мышей Dysf -/- . Уровни CK у мышей A/J, SJL и Dysf -/- были в 4-6 раз выше, чем у родственных инбредных штаммов A (A/HeJ и A/WySnJ) и контрольных однопометных однопометников с дисферлином дикого типа (+/+ ), что указывает на потерю целостности сарколеммы в мышцах с дефицитом дисферлина. Столбики погрешностей указывают на стандартное отклонение, а n относятся к числу проанализированных мышей в каждом наборе.

Рис. 4. Оценка целостности сарколеммы путем витального окрашивания с помощью EBD и уровней CK в сыворотке.Мышам дикого типа и мышам с дефицитом дисферлина внутрибрюшинно вводили EBD, и оценивали поглощение красителя различными мышцами. Макроскопическое исследование мышц живота 20-недельных мышей дикого типа ( A ) и мышей Dysf -/- ( C ) выявило заметное включение EBD в мышцы с дефицитом дисферлина, но не в мышцы дикого типа. (+/+). С помощью флуоресцентной микроскопии мышечные волокна, содержащие EBD, показывают красное цитоплазматическое окрашивание. При микроскопическом анализе не было доказательств поглощения красителя четырехглавой мышцей дикого типа ( B ), но накопление EBD наблюдалось в четырехглавой мышце с дефицитом дисферлина ( D ).( E ) Уровни СК в сыворотке инбредных мышей и мышей Dysf -/- . Уровни CK у мышей A/J, SJL и Dysf -/- были в 4-6 раз выше, чем у родственных инбредных штаммов A (A/HeJ и A/WySnJ) и контрольных однопометных однопометников с дисферлином дикого типа (+/+ ), что указывает на потерю целостности сарколеммы в мышцах с дефицитом дисферлина. Столбики погрешностей указывают на стандартное отклонение, а n относятся к числу проанализированных мышей в каждом наборе.

Рис. 5. Иммунофлуоресцентный и иммуноблот-анализ белков сарколемм в скелетных мышцах с дефицитом дисферлина. ( A ) Криосрезы четырехглавой мышцы бедра мышей дикого типа (+/+), гомозиготных мутантов (Dysf -/- ), мышей A/J и SJL окрашивали антителами против дисферлина (DYSF), дистрофина (DYS ), β-саркогликан (β-SG) и кавеолин-3 (Cav-3). Дисферлин отсутствовал в сарколемме мышей Dysf -/- , A/J и SJL по сравнению с мышами дикого типа, но экспрессия и распределение дистрофина, β-саркогликана и кавеолина-3 не были затронуты.( B ) Иммуноблот-анализ гомогенатов четырехглавой мышцы бедра дикого типа (+/+), гомозиготных мутантов (-/-) A/J и SJL с использованием антител против дистрофина (DYS), β-дистрогликана (β-DG) , дистробревин (DBV), α-саркогликан (α-SG), кавеолин-3 (Cav-3), кальпаин-3 (Calp-3), телетонин (Tel) и синтаза оксида азота нейронов (n-NOS). Экспрессия этих белков не изменялась в мышцах с дефицитом дисферлина.

Рис. 5. Иммунофлуоресцентный и иммуноблот-анализ белков сарколемм в скелетных мышцах с дефицитом дисферлина.( A ) Криосрезы четырехглавой мышцы бедра мышей дикого типа (+/+), гомозиготных мутантов (Dysf -/- ), мышей A/J и SJL окрашивали антителами против дисферлина (DYSF), дистрофина (DYS ), β-саркогликан (β-SG) и кавеолин-3 (Cav-3). Дисферлин отсутствовал в сарколемме мышей Dysf -/- , A/J и SJL по сравнению с мышами дикого типа, но экспрессия и распределение дистрофина, β-саркогликана и кавеолина-3 не были затронуты. ( B ) Иммуноблот-анализ гомогенатов четырехглавой мышцы бедра дикого типа (+/+), гомозиготных мутантов (-/-) A/J и SJL с использованием антител против дистрофина (DYS), β-дистрогликана (β-DG) , дистробревин (DBV), α-саркогликан (α-SG), кавеолин-3 (Cav-3), кальпаин-3 (Calp-3), телетонин (Tel) и синтаза оксида азота нейронов (n-NOS).Экспрессия этих белков не изменялась в мышцах с дефицитом дисферлина.

Рисунок 6. Ультраструктурный анализ мышцы с дефицитом дисферлина. Электронные микрофотографии четырехглавой мышцы мышей дикого типа ( A ) и двух 20-недельных мышей Dysf -/- ( B и C ). В отличие от мышцы дикого типа (А), в мышце с дефицитом дисферлина наблюдалось заметное утолщение и фокальное удвоение базальной пластинки (стрелки, В и С).Кроме того, наблюдалось скопление везикул вблизи сарколеммы (В), а также в изолированных участках разрыва мембраны (стрелка, С) в мышце с дефицитом дисферлина. Бар=200 нм.

Рис. 6. Ультраструктурный анализ мышцы с дефицитом дисферлина. Электронные микрофотографии четырехглавой мышцы мышей дикого типа ( A ) и двух 20-недельных мышей Dysf -/- ( B и C ). В отличие от мышцы дикого типа (А), в мышце с дефицитом дисферлина наблюдалось заметное утолщение и фокальное удвоение базальной пластинки (стрелки, В и С).Кроме того, наблюдалось скопление везикул вблизи сарколеммы (В), а также в изолированных участках разрыва мембраны (стрелка, С) в мышце с дефицитом дисферлина. Бар=200 нм.

Таблица 1.

Краткое изложение характерных особенностей трех линий мышей с дефицитом дисферлина

2 — / — 5 9 91 200
Мышь . Генетический дефект . Эффект мутации . Возраст начала заболевания . Место возникновения . Отличительные признаки .
Dyss
Dyss Удаление экзона 45 Потеря диспенсированного белка ~ 2-месячных проксимальные мышцы (A) Прогрессивная мышечная дистрофия с повышенной сыворотой CK уровни
(б) не агрессивный
A / J A / J ETN вставка в INTONR 4 Потеря Dysferlin белок ~ 5 месяцев проксимальные мышцы (а) похожи на (а) выше, но показать более поздний возраст начала и менее тяжелой мышц гистопатологии, чем DYSF — / — и SJL Mice
(B ) Не агрессивный
(c) Высокая чувствительность к онкогенезу легких
(d) Широко используются для построения Ri, рекомбинантных конхонных и хромосомных замещений
SJL SPLICE STRICE MUTATION MUTATION на Exon 45 Замечаемое уменьшение (~ 85%) У Dysferlin уровень ~2 месяца — старый проксимальные мышцы (а) мышечная гистопатология похожа на DYSF — / — MICE
(b) чрезвычайно Avanessive
(c) очень восприимчивы к аутоиммунным заболеваниям, вирусные инфекции и B-Cell Lymskomas
(D) также несут мутация в гене дегенерации сетчатки 1 (Pde6b rd1 )  
2 — / — 5 9 91 200 Таблица 1.

Краткое изложение характерных признаков трех линий мышей с дефицитом дисферлина

Мышь . Генетический дефект . Эффект мутации . Возраст начала заболевания . Место возникновения . Отличительные признаки .
Dyss
Dyss Удаление экзона 45 Потеря диспенсированного белка ~ 2-месячных проксимальные мышцы (A) Прогрессивная мышечная дистрофия с повышенной сыворотой CK уровни
(б) не агрессивный
A / J A / J ETN вставка в INTONR 4 Потеря Dysferlin белок ~ 5 месяцев проксимальные мышцы (а) похожи на (а) выше, но показать более поздний возраст начала и менее тяжелой мышц гистопатологии, чем DYSF — / — и SJL Mice
(B ) Не агрессивный
(c) Высокая чувствительность к онкогенезу легких
(d) Широко используются для построения Ri, рекомбинантных конхонных и хромосомных замещений
SJL SPLICE STRICE MUTATION MUTATION на Exon 45 Замечаемое уменьшение (~ 85%) У Dysferlin уровень ~2 месяца — старый проксимальные мышцы (а) мышечная гистопатология похожа на DYSF — / — MICE
(b) чрезвычайно Avanessive
(c) очень восприимчивы к аутоиммунным заболеваниям, вирусные инфекции и B-Cell Lymskomas
(D) также несут мутация в гене дегенерации сетчатки 1 (Pde6b rd1 )  
2 — / — 5 9 91 200
Мышь . Генетический дефект . Эффект мутации . Возраст начала заболевания . Место возникновения . Отличительные признаки .
Dyss
Dyss Удаление экзона 45 Потеря диспенсированного белка ~ 2-месячных проксимальные мышцы (A) Прогрессивная мышечная дистрофия с повышенной сыворотой CK уровни
(б) не агрессивный
A / J A / J ETN вставка в INTONR 4 Потеря Dysferlin белок ~ 5 месяцев проксимальные мышцы (а) похожи на (а) выше, но показать более поздний возраст начала и менее тяжелой мышц гистопатологии, чем DYSF — / — и SJL Mice
(B ) Не агрессивный
(c) Высокая чувствительность к онкогенезу легких
(d) Широко используются для построения Ri, рекомбинантных конхонных и хромосомных замещений
SJL SPLICE STRICE MUTATION MUTATION на Exon 45 Замечаемое уменьшение (~ 85%) У Dysferlin уровень ~2 месяца — старый проксимальные мышцы (а) мышечная гистопатология похожа на DYSF — / — MICE
(b) чрезвычайно Avanessive
(c) очень восприимчивы к аутоиммунным заболеваниям, вирусные инфекции и B-Cell Lymskomas
(D) также несут мутация в гене дегенерации сетчатки 1 (Pde6b rd1 )  
2 — / — 5 9 91 200

Каталожные номера

1

Бушби, К.М. (

1999

) Поясно-конечностные мышечные дистрофии — множественные гены, множественные механизмы.

Гул. Мол. Жене.

,

8

,

1875

–1882. 2

Эмери, А.Э. (

2002

) Мышечная дистрофия в новом тысячелетии.

Нервно-мышечная. Беспорядок.

,

12

,

343

–349.3

Лю, Дж., Аоки, М., Илла, И., Ву, К., Фардо, М., Анджелини, К., Серрано, К., Уртизбереа, Дж.А., Хентати, Ф., Хамида, М.Б. и др. (

1998

) Дисферлин , новый ген скелетных мышц, мутирует при миопатии Миёси и мышечной дистрофии пояса конечностей.

Нац. Жене.

,

20

,

31

–36.4

Башир Р., Бриттон С., Страчан Т., Кирс С., Вафиадаки Э., Лако М., Ричард И., Маршан С., Бург Н., Аргов З. и др. (

1998

) Ген, связанный с фактором сперматогенеза Caenorhabditis elegans fer-1, мутирует при поясно-конечностной мышечной дистрофии типа 2B.

Нац. Жене.

,

20

,

37

–42.5

Аоки М., Лю Дж., Ричард И., Башир Р., Бриттон С., Кирс С.М., Олтьен Дж., Браун Х.Е., Маршан С., Бург Н. и др. (

2001

) Геномная организация гена дисферлина и новые мутации при миопатии Миёси.

Неврология

,

57

,

271

–278. 6

Такахаши, Т., Аоки М., Татеяма М., Кондо Э., Мизуно Т., Онодера Ю., Такано Р., Каваи Х., Камакура К., Мотидзуки Х. и др. (

2003

) Мутации дисферлина при японской миопатии Миёси: связь с фенотипом.

Неврология

,

60

,

1799

–1804. 7

Вейлер Т., Башир Р., Андерсон Л.В., Дэвисон К., Мосс Дж.А., Бриттон С., Найлен Э., Кирс С., Вафиадаки Э., Гринберг С.Р. и др. (

1999

) Идентичная мутация у пациентов с мышечной дистрофией пояса конечностей типа 2B или миопатией Миёси предполагает роль генов-модификаторов.

Гул. Мол. Жене.

,

8

,

871

–877.8

Андерсон, Л.В., Дэвисон, К., Мосс, Дж.А., Янг, К., Каллен, М.Дж., Уолш, Дж., Джонсон, М.А., Башир, Р., Бриттон, С., Кирс, С. и др. (

1999

) Дисферлин представляет собой белок плазматической мембраны и экспрессируется на ранних стадиях развития человека.

Гул. Мол. Жене.

,

8

,

855

–861.9

Мацуда, К., Аоки, М., Хаяши, Ю.К., Хо, М.Ф., Арахата, К. и Браун, Р.Х., младший (

1999

) Дисферлин представляет собой белок, ассоциированный с поверхностной мембраной, который отсутствует при миопатии Миёси.

Неврология

,

53

,

1119

–1122. 10

Хо М., Галлардо Э., МакКенна-Ясек Д., Де Луна Н., Илла И.и Браун, Р.Х., младший (

2002

) Новый диагностический анализ на основе крови для мышечной дистрофии пояса конечностей 2B и миопатии Миёси.

Энн. Нейрол.

,

51

,

129

–133. 11

Ачанзар, В.Е. и Уорд, С. (

1997

) Ген нематоды, необходимый для слияния пузырьков спермы.

Дж.Клеточная наука.

,

110

,

1073

–1081. 12

Ясунага С., Грати М., Шардену С., Смит Т. Н., Фридман Т. Б., Лалвани А. К., Уилкокс Э. Р. и Пети К. (

2000

) OTOF кодирует несколько длинных и коротких изоформ: генетическое свидетельство того, что длинные изоформы лежат в основе рецессивной глухоты DFNB9.

утра. Дж. Хам. Жене.

,

67

,

591

–600.13

Дэвис, Д.Б., Дельмонте, А.Дж., Ли, К.Т. и МакНалли, Э. М. (

2000

) Миоферлин, ген-кандидат и потенциальный модификатор мышечной дистрофии.

Гул. Мол. Жене.

,

9

,

217

–226. 14

Бриттон С., Фримен Т., Вафиадаки Э., Кирс С., Харрисон Р., Бушби К. и Башир Р.(

2000

) Третий FER-1-подобный белок человека очень похож на дисферлин.

Геномика

,

68

,

313

–321. 15

Ризо, Дж. и Судхоф, Т.С. (

1998

) С2-домены, структура и функция универсального Са2+-связывающего домена.

Дж. Биол. хим.

,

273

,

15879

–15882.16

Дэвис, Д.Б., Доэрти, К.Р., Дельмонте, А.Дж. и МакНалли, Э. М. (

2002

) Свойства связывания чувствительных к кальцию фосфолипидов нормальных и мутантных доменов С2 ферлина.

Дж. Биол. хим.

,

277

,

22883

–22888. 17

Бансал Д., Мияке К., Фогель С.С., Грох С., Чен С.С., Уильямсон Р., Макнейл, П.Л. и Кэмпбелл, К.П. (

2003

) Восстановление дефектной мембраны при мышечной дистрофии с дефицитом дисферлина.

Природа

,

423

,

168

–172. 18

Биттнер Р.Э., Андерсон Л.В., Буркхардт Э., Башир Р., Вафиадаки Э., Иванова С., Раффельсбергер Т., Мерк И., Хогер Х., Юнг М. и др. (

1999

) Делеция дисферлина у мышей SJL (SJL-Dysf) определяет естественную модель поясно-конечностной мышечной дистрофии 2B.

Нац. Жене.

,

23

,

141

–142. 19

Вафиадаки Э., Рейс А., Кирс С., Харрисон Р., Андерсон Л.В., Раффельсбергер Т., Иванова С., Хогер Х., Биттнер Р.Э., Бушби К. и др. (

2001

) Клонирование мыши дисферлин ген и геномная характеристика мутации SJL-Dysf.

Нейроотчет

,

12

,

625

–629. 20

Веллер А.Х., Маглиато С.А., Белл К.П. и Розенберг, Н.Л. (

1997

) Спонтанная миопатия у мышей SJL/J: патология и потеря силы.

Мышечный нерв

,

20

,

72

–82. 21

Розенберг Н.Л., Рингель С.П., Коцин Б.Л. (

1987

) Экспериментальный аутоиммунный миозит у мышей SJL/J.

клин. Эксп. Иммунол.

,

68

,

117

–129. 22

Восток, Дж.(

1970

) Иммунопатология и новообразования у новозеландских черных (NZB) и мышей SJL-J.

Прог. Эксп. Опухоль рез.

,

13

,

84

–134. 23

Шпиндлер, К.Р., Фанг, Л., Мур, М.Л., Хирш, Г.Н., Браун, К.С. и Кайон, А. (

2001

) Мыши SJL/J очень восприимчивы к заражению мышиным аденовирусом типа 1.

Дж. Вирол.

,

75

,

12039

–12046. 24

Криспенс, К.Г. (

1973

) Некоторые характеристики мышей линии SJL-JDg.

Лаб. Аним. науч.

,

23

,

408

–413. 25

Несбитт, М.Н. и Скамене Э. (

1984

) Рекомбинантные инбредные штаммы мышей, полученные от A/J и C57BL/6J: инструмент для изучения генетических механизмов устойчивости хозяина к инфекции и злокачественным новообразованиям.

Дж. Лейкок. биол.

,

36

,

357

–364. 26

Сэмпсон С.Б., Хиггинс Д.К., Эллиот Р.В., Тейлор Б.А., Людерс К.К., Коза Р.А. и Пейген, Б. (

1998

) Отредактированная карта сцепления для рекомбинантных инбредных линий мышей AXB и BXA.

Мамм. Геном

,

9

,

688

–694. 27

Фестинг, М.Ф. (

1969

) Инбредные мыши в исследованиях.

Природа

,

221

,

716

.28

Мацуда Р., Нишикава А. и Танака Х. (

1995

) Визуализация дистрофических мышечных волокон у мышей mdx путем витального окрашивания синим Эванса: свидетельство апоптоза в мышцах с дефицитом дистрофина.

J. Biochem. (Токио)

,

118

,

959

–964. 29

Штрауб В., Рафаэль Дж. А., Чемберлен Дж.С. и Кэмпбелл, К.П. (

1997

) Животные модели мышечной дистрофии демонстрируют различные модели разрушения сарколеммы.

J. Cell Biol.

,

139

,

375

–385. 30

Хак А.А., Ли С.Т., Цзян Ф., Кленденин С.Дж., Сигрист К.С., Воллманн Р.Л. и МакНалли Э.М.

1998

) Дефицит гамма-саркогликанов приводит к дефектам мышечной мембраны и апоптозу, независимому от дистрофина.

J. Cell Biol.

,

142

,

1279

–1287. 31

Хагивара Ю., Сасаока Т., Араиси К., Имамура М., Ёрифудзи Х., Нонака И., Одзава Э. и Кикучи Т. (

2000

) Дефицит кавеолина-3 вызывает дегенерацию мышц у мышей.

Гул. Мол. Жене.

,

9

,

3047

–3054.32

Пикколо Ф., Мур С.А., Форд Г.К. и Кэмпбелл, К.П. (

2000

) Внутриклеточное накопление и сниженная сарколеммальная экспрессия дисферлина при поясно-конечностных мышечных дистрофиях.

Энн. Нейрол.

,

48

,

902

–912. 33

Сайто А., Хигучи И., Накагава М., Сайто М., Хирата К., Суэхара М., Ёсида Ю., Такахаши Т., Аоки М. и Осаме М. (

2002

) Пациенты с миопатией Миёси с новыми мутациями донорского сайта сплайсинга 5′ показали различное иммуноокрашивание дисферлином в сарколемме.

Акта Нейропатол. (берл.)

,

104

,

615

–620. 34

Тагава К., Огава М., Кавабе К., Яманака Г., Мацумура Т., Гото К., Нонака И., Нишино И. и Хаяши Ю.К. (

2003

) Белковый и генный анализы дисферлинопатии в большой группе японских пациентов с мышечной дистрофией.

Дж. Нейрол. науч.

,

211

,

23

–28. 35

Вайнзоф М., Андерсон Л.В., МакНалли Э.М., Дэвис Д.Б., Фолкнер Г., Валле Г., Морейра Э.С., Паванелло Р. К., Пассос-Буэно М. Р. и Зац М. (

2001

) Анализ белка дисферлина при поясно-конечностных мышечных дистрофиях.

Дж. Мол. Неврологи.

,

17

,

71

–80. 36

Гальбиати Ф., Разани Б. и Лисанти М.П. (

2001

) Кавеолы ​​и кавеолин-3 при мышечной дистрофии.

Тенденции Мол. Мед.

,

7

,

435

–441. 37

Мацуда, К., Хаяси, Ю.К., Огава, М., Аоки, М., Мураяма, К., Нишино, И., Нонака, И., Арахата, К. и Браун, Р.Х., младший (

2001

) Белки сарколеммы дисферлин и кавеолин-3 взаимодействуют в скелетных мышцах.

Гул. Мол. Жене.

,

10

,

1761

–1766.38

Вальтер, М.С., Браун, К., Форгерд, М., Поппе, М., Тирион, К., Шмидт, К., Шрайбер, Х., Книрш, У.И., Бруммер, Д., Мюллер-Фельбер, В. и др. (

2003

) Различное снижение уровня кавеолина-3 у пациентов с LGMD2B/MM.

Дж. Нейрол.

,

250

,

1431

–1438. 39

Андерсон, Л.В., Харрисон Р.М., Поуг Р., Вафиадаки Э., Поллитт К., Дэвисон К., Мосс Дж.А., Кирс С., Пайл А., Шоу П.Дж. и др. (

2000

) Вторичное снижение экспрессии кальпаина 3 у пациентов с мышечной дистрофией пояса конечностей типа 2В и миопатией Миёси (первичные дисферлинопатии).

Нервно-мышечная. Беспорядок.

,

10

,

553

–559.40

Кесслер С., Эллиотт Г.Р., Оренберг Э.К. и Барчас, Дж. Д. (

1977

) Генетический анализ агрессивного поведения двух линий мышей.

Поведение. Жене.

,

7

,

313

–321. 41

Бродкин Э.С., Гофорт С.А., Кин А.Х., Фосселла Дж.А. и Сильвер, Л. М. (

2002

) Идентификация локусов количественных признаков, влияющих на агрессивное поведение мышей.

J. Neurosci.

,

22

,

1165

–1170. 42

Алламанд, В. и Кэмпбелл, К.П. (

2000

) Животные модели мышечной дистрофии: ценные инструменты для разработки методов лечения.

Гул. Мол. Жене.

,

9

,

2459

–2467.43

Селцен Д., Стиллинг Г. и Энгель А.Г. (

2001

) Самые ранние патологические изменения при дисферлинопатии.

Неврология

,

56

,

1472

–1481. 44

Леннон, Н.Дж., Хо, А., Баскай, Б.Дж., Перлмуттер, С.Л., Хайман, Б.Т. и Браун, Р.Х., младший (

2003

) Дисферлин взаимодействует с аннексинами А1 и А2 и опосредует сарколеммальное заживление ран.

Дж. Биол. хим.

,

278

,

50466

–50473. 45

Кальяни Р., Фортунато Ф., Джорда Р., Родолико К., Бональя М.С., Сирони М., Д’Анджело М.Г., Прелле А., Локателли Ф., Тоскано А. и др. (

2003

) Молекулярный анализ пациентов с LGMD-2B и ММ: идентификация новых мутаций DYSF и возможного эффекта основателя в итальянской популяции.

Нервно-мышечная. Беспорядок.

,

13

,

788

–795. 46

МакНалли Э.М., Ли С.Т., Розенманн Х., Митрани Розенбаум С., Цзян В., Андерсон Л.В., Соффер Д. и Аргов З. (

2000

Мутация сплайсинга в дисферлине вызывает поясно-конечностную мышечную дистрофию с воспалением.

утра. Дж. Мед. Жене.

,

91

,

305

–312.47

Вайнер, Л.П., Луи, К.А., Аталла, Л.Р., Кочунян, Х.Х., Ду, Дж., Вей, В., Хинтон, Д.Р., Гордон, Э.М., Андерсон, В.Ф. и Макмиллан, М. (

2004

) Генная терапия на мышиной модели для клинического применения при рассеянном склерозе.

Энн. Нейрол.

,

55

,

390

–399. 48

Линдер, С.С. (

2001

) Влияние генетического фона на спонтанные и генно-инженерные мышиные модели сложных заболеваний.

Лаб. Аним. (Нью-Йорк)

,

30

,

34

–39. 49

Таэте, Л.Г., Несбитт, М.Н. и Малкинсон, А.М. (

1991

) Структура аденомы легкого среди инбредных линий мышей: гены гистологического типа аденомы легкого (Pah).

Рак Летт.

,

61

,

15

–20. 50

Фортин А., Диез Э., Рошфор Д., Ларош Л., Мало Д., Руло Г.А., Грос П. и Скамене Э. (

2001

) Рекомбинантные конгенные штаммы, происходящие от A/J и C57BL/6J: инструмент для генетического анализа сложных признаков.

Геномика

,

74

,

21

–35.51

Маршалл, Дж. Д., Му, Дж. Л., Чеа, Ю. К., Несбитт, М. Н., Франкель, В. Н. и Пейген, Б. (

1992

) Набор рекомбинантных инбредных линий мышей AXB и BXA.

Мамм. Геном

,

3

,

669

–680. 52

Надо, Дж. Х., Сингер, Дж. Б., Матин, А. и Ландер, Э. С. (

2000

) Анализ сложных генетических признаков штаммов с хромосомными заменами.

Нац. Жене.

,

24

,

221

–225. 53

Сингер, Дж. Б., Хилл, А. Э., Беррадж, Л. К., Олсенс, К. Р., Сонг, Дж., Джастис, М., О’Брайен, В. Э., Конти, Д. В., Витте, Дж. С., Ландер, Э. С. и др. (

2004

) Генетическое вскрытие сложных признаков с хромосомными заменами штаммов мышей.

Наука

,

304

,

445

–448. 54

Нисимура М., Хираяма Н., Серикава Т., Канехира К., Мацусима Ю., Като Х., Вакана С., Кодзима А. и Хиаи Х. (

1995

) SMXA: новый набор рекомбинантных инбредных линий мышей, состоящий из 26 сублиний, и их генетический профиль.

Мамм. Геном

,

6

,

850

–857.55

Тифо С., Лалонд Р., Санон Н. и Хамет П. (

2002

) Сравнение между мышами C57BL/6J и A/J по двигательной активности и координации, способности делать отверстия и пространственному обучению.

Мозг Res. Бык.

,

58

,

213

–218. 56

Боннеманн, К.Г., Вонг, Дж., Джонс, К.Дж., Лидов, Х.Г., Финер, К.А., Шапиро Ф., Даррас Б.Т., Кункель Л.М. и Норт К.Н. (

2002

) Первичная гамма-саркогликанопатия (LGMD 2C): расширение мутационного спектра под контролем иммуногистохимического профиля.

Нервно-мышечная. Беспорядок.

,

12

,

273

–280. 57

Кокс Г.А., Коул Н.М., Мацумура К., Фелпс С.Ф., Хаушка С.Д., Кэмпбелл, К.П., Фолкнер, Дж.А. и Чемберлен, Дж.С. (

1993

) Сверхэкспрессия дистрофина у трансгенных мышей mdx устраняет симптомы дистрофии без токсичности.

Природа

,

364

,

725

–729.

Молекулярная генетика человека, Vol. 13, № 18 © Издательство Оксфордского университета, 2004 г.; все права защищены

Вакцина Pfizer снижает риск заражения COVID-19 у детей

Предварительное исследование, опубликованное сегодня на MedRxiv учеными из Королевского колледжа Лондона и ZOE Ltd, анализирует данные 115 775 детей в возрасте 12–17 лет, полученные через приложение ZOE COVID Symptom Study.Данные были представлены после 5 августа 2021 года, на следующий день после того, как правительство Великобритании ввело всеобщую вакцинацию для лиц моложе 18 лет, и до 14 февраля 2022 года. В течение большей части этого периода большинство детей могли получить только одну дозу вакцины Pfizer. В настоящее время клинически уязвимые дети в возрасте 5-11 лет и все 12-17 лет могут получить две дозы, а молодые люди в возрасте 16-17 лет могут получить дополнительную бустерную дозу. Однако настоящее исследование было ограничено только оценкой ответа на однократную дозу.

В нашем документе содержится полезная информация для родителей, рассматривающих возможность вакцинации своих детей от SARS-CoV-2. Даже одна доза вакцины Pfizer означает, что дети и молодые люди с меньшей вероятностью заразятся COVID-19, а в случае заражения после вакцинации у них, вероятно, будет более легкое течение заболевания — по крайней мере, для вариантов Delta и Omicron. Наша статья также обнадеживает, что Омикрон у детей обычно протекает легко, даже у непривитых детей. – Старший автор Эмма Дункан, профессор клинической эндокринологии Школы естественных наук

Исследователи обнаружили значительное и быстрое снижение риска заражения даже после однократной дозы вакцины, достигающей -80.4% и -53,7% через 14–30 дней с вариантами Delta и Omicron соответственно. Это снижение риска сохранялось на уровне -86,4% и -57,9% через 31–60 дней и -61,5% и -63,7% через 61–90 дней.

Исследователи также определили вероятность отсутствия инфекции SARS-CoV-2 как у вакцинированных, так и у непривитых детей. Данные показали расхождение между вакцинированными и невакцинированными детьми почти сразу после вакцинации. Защита со временем ослабла, особенно во времена Омикрона.

Вакцинированные дети, которые ранее сообщили о положительном тесте на SARS-CoV-2, сохраняли риск повторного заражения, близкий к нулю, по крайней мере, в течение 100 дней в течение периода Дельты.Авторы не смогли сделать аналогичный комментарий в отношении Омикрона из-за отсутствия данных. Эти результаты свидетельствуют о том, что вакцинация принесет пользу детям, даже если они ранее были инфицированы COVID-19.

В этом исследовании исследователи снова показали, что COVID-19 обычно протекает в легкой форме у непривитых детей, хотя вакцинированные дети, заразившиеся COVID-19, могут иметь еще более легкое течение. В период Дельты у вакцинированных детей младшего возраста несколько симптомов, включая головную боль, головокружение и резь в глазах, встречались реже, в то время как у детей более старшего возраста также наблюдались более низкие шансы многих симптомов, включая усталость, боль в горле и лихорадку.

Во время периода Омикрон количество симптомов и продолжительность болезни в целом были мягче, чем у Дельта для вакцинированных и непривитых детей. Как вакцинированные, так и невакцинированные дети в возрасте 16-17 лет имели одинаковое бремя болезни без каких-либо существенных различий в шансах для любого отдельного симптома. Однако несколько отдельных симптомов были менее распространены у вакцинированных детей младшего возраста, с более низкими отношениями шансов для аносмии, лихорадки, низкого аппетита, болей в животе и мышечных болей.

Данные также показали, что после вакцинации побочные эффекты в месте инъекции были обычным явлением, при этом чаще всего сообщалось о болезненности руки и локальной боли.Однако системные побочные эффекты, влияющие на весь организм, такие как головная боль и утомляемость, встречались реже (всего 8,3% в возрасте 16–17 лет имели системный побочный эффект и 14,1% в возрасте 12–15 лет). Практически во всех случаях поствакцинальные симптомы быстро стихали. Наконец, очень немногие дети в исследуемой популяции поступали в больницу в периоды Дельта или Омикрон.

Наш документ имеет последствия для будущей политики, касающейся распределения ресурсов здравоохранения и расстановки приоритетов. В целом, однократная доза вакцины уменьшает симптомы COVID-19, но обеспечивает ограниченную по времени защиту от инфекции, особенно для Омикрона.Наше исследование также показывает, что приобретенный иммунитет к инфекциям является дополнительным защитным фактором. Обнадеживает тот факт, что дети хорошо выздоравливают после заражения SARS-CoV-2 с помощью Delta и Omicron. – Доктор Майкл Абсуд, старший автор исследования, консультант и читатель
.

Leave a Reply

Ваш адрес email не будет опубликован.

Мышь . Генетический дефект . Эффект мутации . Возраст начала заболевания . Место возникновения . Отличительные признаки .
Dyss
Dyss Удаление экзона 45 Потеря диспенсированного белка ~ 2-месячных проксимальные мышцы (A) Прогрессивная мышечная дистрофия с повышенной сыворотой CK уровни
(б) не агрессивный
A / J A / J ETN вставка в INTONR 4 Потеря Dysferlin белок ~ 5 месяцев проксимальные мышцы (а) похожи на (а) выше, но показать более поздний возраст начала и менее тяжелой мышц гистопатологии, чем DYSF — / — и SJL Mice
(B ) Не агрессивный
(c) Высокая чувствительность к онкогенезу легких
(d) Широко используются для построения Ri, рекомбинантных конхонных и хромосомных замещений
SJL SPLICE STRICE MUTATION MUTATION на Exon 45 Замечаемое уменьшение (~ 85%) У Dysferlin уровень ~2 месяца — старый проксимальные мышцы (а) мышечная гистопатология похожа на DYSF — / — MICE
(b) чрезвычайно Avanessive
(c) очень восприимчивы к аутоиммунным заболеваниям, вирусные инфекции и B-Cell Lymskomas
(D) также несут мутация в гене дегенерации сетчатки 1 (Pde6b rd1 )