Спинномозговая анестезия при кесаревом сечении: польза или вред? — Ozon Клуб

Содержание

Спинальная анестезия при кесаревом сечении

Шурыгин И.А.
СПИНАЛЬНАЯ АНЕСТЕЗИЯ ПРИ КЕСАРЕВОМ СЕЧЕНИИ.

ПРЕДИСЛОВИЕ

Данной электронной публикацией мы открываем дискуссию о применении спинальной анестезии в акушерской практике и приглашаем принять в ней участие всех, кто уже использует этот метод или намерен освоить его. Для затравки мы приводим детальное описание собственного опыта в этой области, где откровенно рассказываем о своих взглядах на предмет, трудностях, проблемах, достижениях и планах. В процессе освоения этого метода и далее, при постоянном использовании его в практической работе нам довелось открыть для себя огромный пласт интереснейших и разнообразных проблем, которые редко попадают в поле зрения анестезиологов, не знакомых с нейроаксиальными методами обезболивания. Мы поделимся с Вами ответами на многие вопросы, которые возникали у нас как в процессе освоения метода, так и при использовании его в повседневной работе. Мы отдаем себе ясный отчет в том, что наша точка зрения на многие спорные аспекты спинальной анестезии — всего лишь одна из многих.

Присоединяйтесь.

В тексте Вы встретите обозначения  — это контекстные гиперссылки на те фрагменты публикации, где содержатся более подробные сведения о тех или иных аспектах темы. В связи с тем, что мы намерены публиковать работу по частям по мере их готовности, гиперссылки на неопубликованные части временно остаются неактивным: заранее приносим извинения за это неудобство. В ближайшее время появятся и гиперссылки на иллюстрации.

Регионарной анестезии в нашей стране не очень то повезло. Начало было, как обычно, многообещающим, конец оказался, как водится, бесславным. В начале 20-го века, когда спинальная, а несколько позже и эпидуральная анестезия еще только появились на свет, российские врачи с энтузиазмом восприняли новые идеи, пришедшие из Германии, и в течение первой половины века внесли свой солидный вклад в развитие регионарного обезболивания. Достаточно вспомнить такую фигуру, как С.С.Юдин, чье капитальное руководство «Спинномозговая анестезия», обобщившее 25-летний мировой опыт применения метода, и сейчас читается с огромным наслаждением. Однако в течение последних пяти десятилетий сначала инфильтрационная, а затем и сделавшая мощный рывок в своем развитии общая анестезия вытеснили регионарные методы операционного обезболивания на глухие задворки отечественной медицины. Фактически возникла своего рода негласная традиция считать эпидуральную, и тем более, спинальную анестезию замшелым, второсортным и малоинтеллектуальным делом. Я хорошо помню, как однажды, в начале 80-х годов, был поражен, узнав, что одна моя знакомая была оперирована в Ленинграде в условиях спинальной анестезии. «Есть же еще на свете дикари…» — такой была моя первая реакция на это известие. Думаю, что абсолютное большинство моих коллег в те годы ответили бы подобным же образом. Такая реакция полностью соответствовала официальному отношению к этим методам, получить представление о котором можно, полистав отечественную анестезиологическую литературу того времени, включая немногочисленные и столь дефицитные в те годы руководства и учебники по анестезиологии, не содержащие даже упоминания об СА и ЭА. Справедливости ради стоит заметить, что и в те времена «кто-то кое-где у нас порой» занимался спинальными методами обезболивания в основном в урологии и в акушерстве, но эти редкие, и потому достойные особого уважения случаи не делали общей погоды на просторах нашей Родины. Так и получилось, что в России, никогда и ни в чем не знающей меры, последние 30-40 лет составили эпоху безраздельного господства наркоза, которая продолжается и поныне, а спинальная анестезия, когда-то столь любовно взрощенная С.С.Юдиным и многими другими первоклассными специалистами, была попросту уничтожена как класс. Эпидуральной повезло чуть больше, но и ее судьбу в нашей стране удачной не назовешь.

Возврат спинальной анестезии на лихие просторы отечественной медицины пришелся на начало-середину 90-х годов. Причин тому было несколько: открылся широкий доступ к зарубежной литературе, некоторым врачам удалось «скататься за бугор» и посмотреть, как работают там, появилась возможность пользоваться импортными иглами и хорошими местными анестетиками, претерпели кардинальные изменения фармакологические основы метода. Но главное, проблема просто созрела, и не замечать ее дальше стало уже невозможно.

Если я ошибаюсь, поправьте меня, но, насколько мне известно, в отечественном акушерстве ближайшая родственница СА — эпидуральная анестезия — как метод обезболивания родов получила определенное распространение, начиная с начала 70-х годов. К сожалению, судя даже по самым свежим публикациям, сами акушеры до сих пор толком не понимают потенциальных возможностей этого метода, и все описания ЭА в отечественных акушерских руководствах даже последних лет отличаются узостью взглядов, примитивностью запросов и явной отсталостью подходов. Впрочем, ЭА в современном акушерстве — это отдельная тема, требующая большого разговора, который обязательно состоится на нашем сайте.

Спинальная же анестезия (СА) в нашей стране внедряется в практику единичных родильных домов только в последние годы, и исключительно усилиями энтузиастов.

Между тем, за рубежом СА является стандартным методом анестезиологического пособия при КС

. Число публикаций на эту тему исчисляется многими тысячами, и в каждом руководстве по акушерской анестезиологии проблемам СА посвящается солидный раздел. Этот метод рекомендуется в качестве оптимального для развивающихся стран, но он же состоит на вооружении самых престижных клиник Америки и Азии, Западной Европы и Австралии.

Однако лучше всяких слов об этом говорит статистика. В 1997 г. в мире 16,7% беременных были родоразрешены операцией КС. В условиях регионарной (спинальной или эпидуральной) анестезии было выполнено:


  • в США: 84% всех КС,

  • в Норвегии: 60%

  • в Великобритании: 52%

  • в Венгрии: 37%

  • в Германии: 37%

  • в России: я думаю, нет такого микроскопа, чтобы разглядеть эту цифру

Что же мешает широкому распространению этого метода в нашем отечестве? С нашей точки зрения, тому есть несколько причин.

Во-первых, невероятная инертность нашего здравоохранения во всем, что касается нормальных инициатив, лежащих в основе любого развития. Однажды привыкнув выполнять любые, даже простейшие вмешательства в условиях наркоза, и узаконив это положение во всех руководствах и методических рекомендациях, наше акушерство с трудом воспринимает альтернативные возможности, а чаще попросту встречает их в штыки.

Второй причиной является исключительная бедность отечественных традиций в области регионарной анестезии в целом. Опыт систематического применения этих методов имеется лишь в отдельных лечебных учреждениях, и лишь в отдельных областях медицины. В целом же ниша, которую должны на нормальных, законных основаниях занимать нейроаксиальные методы обезболивания в общей структуре методов анестезии до сих пор не определена, и нет даже намеков на то, что это будет когда либо сделано. Во многих лечебных учреждениях эпидуральная или спинальная анестезия воспринимаются как экзотические штучки, а не как нормальная рутина. В одном из последних акушерских руководств (Е.А.Чернуха: Родовой блок. М.,Триада-Х, 1999 г.) прямо говорится: «По нашим данным в отдельных клиниках нашей страны частота эпидуральной аналгезии в родах составляет 5%.». Заметьте, «в отдельных клиниках»! И это — эпидуральная аналгезия для которой любой роддом должен быть заповедником, инкубатором, полигоном! Я не сомневаюсь, что если подсчитать частоту применения в нашей стране спинальной анестезии на операциях кесарева сечения, то речь, в лучшем случае, пойдет о сотых долях процента.В нормальных странах нейроаксиальными методами обеспечивают 40-70% абдоминальных родоразрешений (регулярно и обильно публикуемая статистика).

В-третьих, может быть кто-нибудь сможет сообщить, в каком медицинском учебном центре заинтересованный специалист имеет возможность официально обучиться спинальной анестезии в акушерстве не на словах, а на деле? На своем опыте мы хорошо усвоили, что практика СА в акушерстве содержит массу нюансов, без знания которых в эту область лучше не соваться — расплата будет быстрой и жестокой. И эти нюансы желательно постигать не ценой проб и ошибок, а перенимая опыт у компетентных специалистов в операционной. Весь позор ситуации заключается в том, что когда то наша страна располагала множеством превосходных профессионалов, тонко понимавших СА и применявших этот метод на уровне лучших мировых стандартов. Но однажды каток тоталитарной медицины проехался по этим достижениям, не оставив от них и следа. В результате нынешнее поколение анестезиологов большей частью даже не представляет себе, зачем нужны эти методы, а редкие желающие им обучиться вынуждены искать информацию в зарубежных книгах и статьях. Без помощи профессионала и свободного доступа к специальной литературе процесс самостоятельного освоения метода может оказаться затянутым, рыхлым, со многими издержками и неоправданными разочарованиями.

Четвертой проблемой является почти полный информационный вакуум, в котором находятся эти методы в нашей стране. Это особенно касается спинальной анестезии, по которой в современной отечественной литературе невозможно найти не то, чтобы руководства — хоть какой-нибудь завалящей журнальной статьи. Единичные публикации, в которых можно обнаружить упоминания или скудный набор сведений об этом методе написаны либо не анестезиологами(!), либо анестезиологами, никогда не державшими в руках спинальной иглы (это очень сильно чувствуется по множеству ляп в тексте, которые профессионал никогда бы не сделал), либо анестезиологами, не имеющими ни малейшего понятия о специфике обезболивания в акушерстве.

Вообще, знакомство с отечественной акушерско-анестезиологической литературой — неплохой способ понять, почему наша страна находится на одном из самых позорных мест в мире по материнской и перинатальной смертности. Россия, видимо, остается последним в мире заповедником, где руководства, методические рекомендации и прочие наставления по акушерской анестезии и интенсивной терапии сочиняются по старинке исключительно акушерским начальством так же, как это делали их отцы и деды в те времена, когда один хирург капал эфир на маску Эсмарха, а другой выполнял чревосечение. Читая даже самые последние руководства и монографии, трудно отделаться от мысли, что они пишутся людьми, для которых время остановилось в 60 — 70-х годах, и никакая косметика типа кокетливых упоминаний о препаратах гидроксиэтилкрахмала, диприване, длительной эпидуральной инфузии или спинальной анестезии не в состоянии замазать это впечатление.

Правила жизни в нашем отечестве не позволяют надеяться на то, что однажды, насосавшись дармовых грантов, одурев от презентаций, и утомившись от лоббирования крахмально-гелофузиновых интересов фармацевтических фирм, акушерско-анестезиологическая администрация всея Руси займется наконец настоящим, серьезным и полезным делом — приведением отечественной акушерской анестезиологии и интенсивной терапии в мало-мальское соответствие нормам и стандартам передовых стран. Но это не значит, что таким делом не займутся и те, на чьи головы периодически стекают продукты жизнедеятельности нашей элиты.

Часть 1.
ПРЕДВАРИТЕЛЬНЫЕ ЗАМЕЧАНИЯ

Несколько слов о терминах.


  • Нейроаксиальная анестезия — общее название группы методов обезболивания, воздействующих непосредственно на спинной мозг и его корешки (axis — ось). Другие названия этой группы — «методы центральной блокады», спинальные методы обезболивания» или «центральная сегментарная блокада».

  • Эпидуральная анестезия (ЭА) — блокада всех видов чувствительности, соматической и вегетативной (проприоцептивной, болевой, температурной и др.), которая достигается введением местного анестетика в эпидуральное пространство. Другими компонентами блокады являются сегментарная миорелаксация и десимпатизация. ЭА вызывается концентрированными растворами местных анестетиков (МА). Синонимы: перидуральная, экстрадуральная, эпитекальная анестезия.

  • Эпидуральная аналгезия, в отличие от анестезии — блокада болевой чувствительности при сохранении или незначительном угнетении остальных видов чувствительности и мышечного тонуса. Достигается введением в эпидуральное пространство наркотических аналгетиков, клофелина, кетамина, слабоконцентрированных растворов местных анестетиков или различных комбинаций этих препаратов. При использовании разбавленных растворов МА наряду с блокадой соматической боли прерывается импульсация по тонким волокнам симпатической системы &

  • Спинальная анестезия (СА) — блокада всех видов чувствительности, которая достигается введением местного анестетика в цереброспинальную жидкость (ликвор), заполняющую субарахноидальное пространство. Спинальной анестезии сопутствует регионарная миорелаксация и десимпатизация, а в отдельных случаях и некоторые церебральные эффекты, обусловленные миграцией препаратов в краниальном направлении (седативный эффект, подавление кашля и дыхания, центральная рвота, угнетение сосудодвигательного центра, нарушение терморегуляции и некоторые другие). Синонимы: спинномозговая, субарахноидальная, интратекальная анестезия. Иногда этот вид обезболивания неправильно называют «субдуральной анестезией», хотя для того, чтобы преднамеренно ввести анестетик в субдуральное пространство (между твердой и паутинной оболочками, плотно прилежащими друг к другу), надо по меньшей мере иметь в голове аппарат для ЯМР. Во всем мире повсеместное распространение получил термин «спинальная анестезия», поэтому мы будем пользоваться им, хотя в России с начала 20-го века традиционно более популярен термин «спинномозговая анестезия».

  • Спинальная аналгезия — прочитав предыдущие определения, о значении этого термина догадаться несложно. В отличие от эпидуральной, при спинальной аналгезии риск миграции препарата по ликворным путям в полость черепа и развития церебральных симптомов оказывается существенно выше. Применяется для обезболивания родов или в послеоперационном периоде.

Следует иметь в виду, что приведенная классификация основана на способе введения препаратов — и только. Вместе с тем, при эпидуральной анестезии часть препарата (нередко — весьма значительная) проникает через твердую мозговую и паутинную оболочки в ликвор и действует непосредственно на спинной мозг и его корешки, т.е. возникает спинальный компонент блока. И наоборот, вскоре после введения анестетика в ликвор можно обнаружить его присутствие в клетчатке эпидурального пространства. Кроме того, при спинальной анестезии часть препарата может мигрировать в краниальные отделы субарахноидального пространства, воздействуя на бульбарные и церебральные структуры, в результате чего анестезия по сути может оказаться далеко не только спинномозговой.

Преимущества нейроаксиальных методов операционной анестезии

Перечислим основные достоинства СА и ЭА как методов операционного обезболивания в акушерстве. В целом я определил бы их как достижение максимального эффекта минимальными средствами и с минимальными издержками. Об этом когда-то прекрасно сказал С.С.Юдин: «Только самые глубокие общие наркозы в состоянии столь полно уничтожить болевые ощущения, как это достигается легко самыми небольшими дозами алкалоида.».


  1. На сегодняшний день это единственные методы анестезии, способные обеспечить надежную, близкую к 100% антиноцицептивную защиту. Имеется в виду не только их противоболевой эффект (он может быть достигнут и общими анестетиками), но, что не менее важно, их способность прерывать всю патологическую импульсацию из зоны операции, в том числе и неболевую. Регионарная анестезия не пытается «копаться в мозгах» пациентов, она просто обрывает всю связь зоны операции и прилегающих областей с центром, лишая последний информации о происходящем. Использование нейроаксиальной анестезии как самостоятельного метода или в качестве компонента комбинированного обезболивания обеспечивает самую надежную защиту пациента от операционного стресса.

  2. Применение СА или ЭА позволяет избежать многих вынужденных действий, которые сами по себе могут стать причиной мелких и крупных неприятностей (применение миорелаксантов, интубация трахеи, ИВЛ, использование общих анестетиков, вызывающих депрессию новорожденного, гипотензивных препаратов и проч.).

  3. Сводится практически к нулю риск аспирационных осложнений.

  4. Операции, выполненные в условиях СА или ЭА отличаются значительно меньшим объемом кровопотери (на 20 — 40% по сравнению с общей анестезией). Механизм прост: отсутствие эпизодов артериальной гипертензии, депонирование большого объема крови в нижерасположенных областях и относительное «обескровливание» зоны операции (блокируются рефлексы симпатической системы, регулирующие справедливое распределение кровотока между регионами и обеспечивающие относительную независимость этого распределения от гравитации).

  5. В акушерстве использование СА или ЭА позволяет обеспечить качественную анестезию в пренатальном периоде КС, в отличие от кастрированных вариантов барбитурово-закисного наркоза, до сих пор пропагандируемых мастодонтами отечественного акушерства. Исчезает необходимость в форсированной лапаротомии и быстром извлечении плода, чтобы предотвратить его депрессию общими анестетиками. Доступ выполняется хирургами спокойно, с качественным гемостазом и аккуратной препаровкой тканей. Депрессия новорожденных, обусловленная анестезией, практически отсутствует.

  6. Отличное самочувствие оперированных женщин в послеоперационном периоде, возможность ранней их активизации, резкое снижение риска появления многих классических послеоперационных проблем и осложнений кроме тех, которые обусловлены техническими особенностями операции и сопутствующей патологией. Остается интактной перистальтика кишечника.

  7. Длительная послеоперационная аналгезия. Резкое снижение потребности в наркотиках после операции &

  8. Низкая по сравнению с наркозом стоимость обезболивания. Существенное снижение трудозатрат персонала как в операционной, так и в восстановительной палате (СА).

Недостатки СА и ЭА

Следует помнить и о недостатках нейроаксиальных методов обезболивания. Они есть, и достаточно серьезны.



  1. Трудности при пункции субарахноидального или эпидурального пространства встречаются чаще, чем трудности при интубации трахеи. Минимальный вред, который они причиняют — задержка с началом операции. В отдельных случаях технические трудности вынуждают отказаться от нейроаксиального обезболивания в пользу наркоза. Правда, и СА или ЭА в свою очередь могут крепко выручить анестезиолога, когда не удается интубировать трахею.

  2. Всегда существующий риск развития некачественного блока (односторонний, мозаичный, недостаточный по распространенности или по глубине). Эти проблемы значительно более характерны для ЭА, чем для СА.

  3. Ограниченная продолжительность СА. В настоящее время эта проблема решается двумя способами: (1) техническим — катетеризацией субарахноидального пространства или комбинированной спинально-эпидуральной методикой и (2) фармакологическим — применением местных анестетиков длительного действия или специальных адъювантов, усиливающих и продляющих анестезию, вызванную основным препаратом &

  4. Высокий риск развития неблагоприятных гемодинамических реакций & Кстати, может показаться странным, но до сих пор не сделаны окончательные выводы о том, как влияют колебания параметров гемодинамики при СА на состояние плода. В тех статьях, которые мне удалось разыскать, утверждается, что артериальная гипотония у матери во время СА не приводит к изменению пуповинного кровотока, развитию фетального ацидоза и снижению баллов Апгар, но крупномасштабных исследований этой проблемы, похоже, не проводилось.

  5. Нерешенность проблемы профилактики гемодинамических расстройств &

  6. Применение некоторых адъювантов связано с риском депрессии дыхания пациентки &&

  7. Проблема постпункционного синдрома, который в большинстве случаев реализуется постпункционной головной болью (ППГБ). Эта проблема особенно актуальна именно в акушерской анестезиологии &

Сравнительная оценка СА и ЭА

Сравним ЭА и СА как методы операционной анестезии при кесаревом сечении.

Преимущества ЭА перед СА


  1. Более плавное развитие блока, и соответственно, менее резкое действие на кровообращение

  2. Неограниченная длительность операционной анестезии

  3. Обеспечение продолжительной послеоперационной аналгезии

Эти преимущества существенно возрастают при толковом использовании современных адъювантов.

Недостатки ЭА в сравнении с СА


  1. В большинстве случаев при ЭА качество обезболивания заметно ниже, чем при СА

  2. Существенно больший процент неудач (недостаточная анестезия и/или релаксация, монолатеральный, мозаичный блок и т.д.)

  3. Медленное развитие анестезии (резко ограничивает, а иногда и полностью исключает применение в срочных случаях)

  4. Тяжелые последствия непреднамеренного внутривенного введения местного анестетика (вплоть до остановки сердца). Особенно это относится к бупивакаину, кардиотоксичность которого особенно высока при беременности.

  5. Тяжелейшие последствия непреднамеренного введения эпидуральной дозы препарата в субарахноидальное или в субдуральное пространство.

  6. Риск развития эпидуральной гематомы или абсцесса (осложнения из разряда редчайших)

  7. Более трудоемкий и дорогой метод

Преимущества СА перед ЭА

  1. Проще в техническом отношении. Выполняется быстрее. Эффект развивается в течение нескольких минут: пригодна для обеспечения большинства срочных операций.

  2. Значительно более высокое качество блока. Безупречный обезболивающий эффект наблюдается в абсолютном большинстве случаев.

  3. Максимальная релаксация мускулатуры в блокированных сегментах.

  4. Использование современных местных анестетиков и адъювантов позволяет существенно увеличивать продолжительность операционной спинальной анестезии и обеспечивает длительную послеоперационную аналгезию &

  5. Использование препаратов в малых дозах исключает возможность развития системных токсических реакций даже при непреднамеренном внутривенном введении.

  6. При разумном подходе к делу СА значительно дешевле общей и эпидуральной анестезии. Разумеется, если применять для подготовки гидроксиэтилкрахмал и пользоваться иглами карандашного типа, то на этом преимуществе метода можно поставить жирный крест.

Недостатки СА

  1. Более жесткое влияние на кровообращение и дыхание.

  2. Неуправляемость и ограниченная длительность анестезии.

  3. Постпункционная головная боль (ППГБ). &

Приступая к освоению спинальной анестезии без которой сейчас мы не представляем свою работу, мы уже располагали успешным опытом выполнения КС в условиях эпидуральной анестезии, а также имели в своем активе несколько случаев проведения продленной спинальной анестезии как в родах, так и при КС, после случайного прокола твердой мозговой оболочки (ТМО) с последующей преднамеренной катетеризацией канала. Поэтому весь период освоения нового для нас метода занял около полугода и прошел относительно бескровно как для пациенток, так и для врачей.

В настоящее время общая частота применения СА при кесаревых сечениях (срочных и плановых) у нас составляет 70 — 72%. Методом полноценно владеют все врачи, работающие в акушерском стационаре. Эпидуральная анестезия, не выдержав конкуренции, полностью сошла со сцены нашего операционного театра, уступив место своей неувядающей старшей сестре. Даже в тех случаях, когда кесареву сечению предшествует продленная эпидуральная аналгезия в родах, операцию мы всегда обеспечиваем методом СА, а эпидуральный катетер используем в послеоперационном периоде.

Недавно довелось полистать переведенное на русский язык капитальное руководство по анестезиологии, составленное А.Р.Эйткенхедом и Г.Смитом (М., Мед., 1999), кстати, весьма удачное, где в разделе, посвященном вопросам акушерской анестезиологии с удовольствием прочитал : «Применение локальной блокады при КС продолжает возрастать. … Процент плановых КС осуществляемых при экстрадуральной аналгезии быстро снижается вследствие … совершенствования методов субарахноидального блока.» (том 2, стр. 256).

Следует заметить, что столь высокая частота применения СА может показаться непривычной для многих российских анестезиологов, но в некоторых странах дальнего зарубежья считается признаком нормального положения дел в акушерском стационаре. Кстати, мы с самого начала не ставили перед собой цель вывести этот показатель на определенный уровень к определенному сроку — он сложился естественным образом из формулы «показание есть необходимость при отсутствии неприемлимого риска или более удачной альтернативы». Мы с удовольствием наблюдали за тем, как по мере накопления опыта круг противопоказаний для СА неуклонно суживался, пока не стабилизировался в своем нынешнем виде.

Мы рассматриваем спинальную анестезию в акушерстве не только и не столько как свою новую любимую игрушку: она является важнейшей составной частью программы ранней активизации пациентки в послеоперационном периоде. Эта программа включает:


  • Раннее установление контакта между матерью и новорожденным (в обязательном порядке начинается с прикладывания ребенка к материнской груди во время операции и возобновляется почти сразу после доставки больной в послеоперационную палату &

  • Сведение к абсолютному минимуму медикаментозной агрессии в отношении родильницы; резкое снижение потребности в наркотических препаратах при гарантии удовлетворительного качества послеоперационного обезболивания &

  • Уменьшение операционной кровопотери (свойственно методу СА) и резкое сокращение формальных поводов для бича отечественного акушерства — безудержной и безмозглой инфузии коллоидов и компонентов крови.

  • Сокращение периоперационной инфузионной терапии до объема физиологической потребности &&

  • Раннее, сразу после поступления в восстановительную палату, разрешение пить минеральную воду без ограничения количества выпитой жидкости (кстати, углекислый газ минеральных вод является отличным стимулятором перистальтики и секреции).

  • Раннее, через 4-10 часов после КС, кормление женщины полноценной пищей (стол 10). Любопытно, что во многих случаях в первые же часы после операции, выполненной в условиях СА, женщины отмечают появление хорошего аппетита. Но, зная, что традиционно в первые сутки послеоперационного периода больных кормить не положено, пациентки просто не считают нужным сообщать об этом врачу и терпеливо голодают.

  • Ранний подъем с кровати (после исчезновения симпатического блока) &

  • Отказ от инфузионной терапии на вторые сутки после операции за ненадобностью (кормление и питье в полном объеме).

Все эти принципы нам удалось реализовать и поставить «на конвейер». Разумеется, особенности конкретных больных иногда вынуждают отступать от перечисленных выше правил, но таких случаев — явное меньшинство.

Следует отметить, что мы не признаем никакого диктата врачей в отношении пациенток, предпочитая вести с ними конструктивный диалог. В тех случаях, когда это допустимо (а таких — большинство), всегда стараемся давать больным максимальную свободу выбора. Все перечисленные выше принципы (кроме 3, 4 и 8) носят разрешительный, а не приказной характер. Это означает, что женщины, ориентируясь на собственное самочувствие, сами решают, нуждаются ли они в инъекции аналгетика, хватит ли у них сил и желания активно заниматься ребенком, и стоит ли сегодня вставать с кровати. Мы не помним ни одного случая, чтобы такая тактика причинила какой либо вред.

Общие неформальные впечатления от СА при КС:

Анестезиологи:

СА подкупает высочайшим, обычно безупречным качеством обезболивания. В типичных случаях при СА пациентка узнает о том, что операция уже выполняется, только если ей об этом сообщают. Имея в своем активе большой и весьма положительный опыт применения эпидуральной анестезии, мы по-настоящему поняли, что такое регионарное обезболивание, только занявшись СА, и сравнения здесь оказались не в пользу ЭА. Основной недостаток СА — высокая частота потенциально неблагоприятных гемодинамических реакций && Проблема ограниченной длительности операционной анестезии радикально и без труда решается рациональным выбором комбинации доступных препаратов &

Акушеры:

Отличная релаксация, отчетливое снижение кровопотери. Возможность спокойного, неспешного доступа с качественным гемостазом и аккуратной препаровкой тканей. Идеальный метод для обучения технике операции интернов. Высокие баллы Апгар. Ранняя активизация пациентки после операции. Раннее начало кормления привело к почти полному исчезновению пареза кишечника.

Основной показатель: своих знакомых наши акушеры весьма настойчиво предпочитают оперировать в условиях СА.

Основной минус — во время операции акушерам приходится сдерживать свои эмоции, выбирать слова и ограничивать себя в разговорах.

Возникновение в редких случаях постпункционной головной боли омрачает течение послеоперационного периода, приковывает пациентку к кровати, лишает возможности активно заниматься ребенком. & Проблема радикально решается методом пломбировки эпидурального пространства аутокровью. Процедура из разряда простейших, результативность близка к 100%, с осложнениями встречаться не доводилось. &

Неонатологи:

Отсутствие медикаментозной депрессии новорожденных. Это особенно ценно при преждевременных родах, случаях гипоксии плода и ЗВУР. Возможность прикладывания ребенка к груди в операционной (раннее грудное вскармливание) & Женщина начинает активно заниматься ребенком вскоре после окончания операции (совместное пребывание в восстановительной палате).

Приступая к освоению метода, мы четко определили свои предварительные требования к нему. Наша принципиальная позиция заключается в том, что врач не должен оказаться в положении заложника метода, идя на все ради возможности его применять.


  • Мы были готовы отказаться от СА, если ценой должно было стать систематическое и существенное увеличение общего объема инфузионной терапии и, тем более, включение в ее состав препаратов специального назначения, которые в принципе не должны применяться без особой необходимости (декстраны, ГЭК и проч.).

  • Методика должна быть предельно простой (максимальный эффект минимальными средствами).

  • Из финансовых соображений метод мог быть поставлен на конвейер только при условии использования недорогих отечественных препаратов.

  • Новый метод должен помогать решать некоторые существующие проблемы, а не добавлять неприемлимые новые.

Вместе с тем, мы прекрасно понимали, что безупречных методов анестезии не существует, и что нам обязательно придется столкнуться с некоторыми неприятными особенностями СА. Вопрос заключался лишь в том, насколько эффективными и малозатратными окажутся наши ответные меры.

В период освоения метода мы усвоили несколько простых истин.

Во-первых, не следует безоговорочно верить всему, что написано в руководствах, статьях, методических рекомендациях и прочих публикациях (включая и ту, что вы читаете в настоящий момент). Сейчас, имея опыт применения СА, мы понимаем, как дорого могла бы обойтись нам слепая вера в печатное слово. Сведения по спорным вопросам, содержащиеся в литературе, следует воспринимать лишь как личные впечатления авторов, которые могут подтвердиться, а могут и не подтвердиться Вашей личной практикой. СА относится к тем методам, относительно которых в литературе нередко имеются диаметрально противоположные, взаимоисключающие мнения, впрочем, в каждом случае подкрепленные солидной статистикой. Поэтому никогда не делайте окончательные выводы по одному-единственному литературному источнику. К примеру, рекомендуемые в разных источниках дозы клофелина для субарахноидального применения находятся в диапазоне от 30 до 700 мкг (!), и список подобных несообразностей и противоречий можно продолжить до бесконечности. Окончательно установленных истин в области СА не так уж и много.

Во-вторых,как и в любом другом деле, успех приходит с опытом. Различные неудачи и шероховатости в начале освоения СА неизбежны, но не должны приводить в отчаяние. К сожалению, в нашей стране отсутствуют тренировочные или учебно-методические центры, поэтому расчитывать здесь приходится на свои силы. При этом все решения, принимаемые анестезиологом в любой неоднозначной ситуации должны быть подчинены идее безопасности пациентки: вопросы личного престижа, амбиции, усталость, конфликты в бригаде и прочие парамедицинские проблемы не должны иметь никакого значения. Следует также помнить, что по мере накопления опыта проблемы имеют свойство рассасываться.

В-третьих, главным ключом к успеху мы считаем удачную рецептуру. Качество, продолжительность и безопасность СА на 2/3 определяются качественным и количественным составом применяемой комбинации препаратов. Все остальное — преинфузия, премедикация с вазопрессором и прочие превентивные действия, вычурное операционное положение и другие ухищрения не позволяют радикально предотвратить появление проблем, типичных для СА. Более того, во многих случаях перечисленные выше, и некоторые другие ритуалы являются в конечном итоге неосознанными попытками нивелировать дефекты рецептуры. Применяя ту или иную смесь, врач становится ее заложником. Например, включение в состав комбинации клофелина позволяет существенно продлить операционную анестезию и седацию, а также обеспечить многочасовую послеоперационную аналгезию, но при этом заметно возрастает частота возникновения артериальной гипотонии и брадикардии, для борьбы с которыми иногда приходится применять достаточно агрессивные меры. Ниже мы представим свой вариант комбинации препаратов и обсудим его в деталях &

В-четвертых, наша жизнь значительно облегчилась, когда мы, наконец, осознали, что норма здорового человека может существенно отличаться от нормы пациента во время спинномозгового блока &
Например, о показателях гемодинамики (пульс, АД) следует судить не только по абсолютным значениям, но и по их реальному влиянию на минутный объем кровообращения и распределение кровотока , а также на общее состояние пациентки. У нас создалось впечатление, что понятие «нормальный» при СА следует заменить на «приемлимый» или «допустимый». Кстати, подобный взвешенный подход в том или ином виде встретился нам во многих публикациях, исходящих от практиков. Примером может служить распространенная рекомендация не стремиться во что бы то ни стало ликвидировать брадикардию эфедрином или атропином, если частота пульса остается больше 50 в мин, и больная при этом чувствует себя удовлетворительно. Формальная трактовка показателей (напр., «гипотония — это снижение АДсист более чем на 20% от исходного уровня») во многих случаях является стимулом для коррекции отклонений, не влияющих на здоровье пациентки и плода и потому не требующих нашего вмешательства. Словом, при СА необходимо уметь отличать изменения параметров, к которым можно относиться спокойно от тех, с которыми следует решительно и энергично бороться. Кстати, этим отличается опытный охотник, стреляющий только в ценную дичь, от новичка, который палит по всему, что двигается.

В-пятых, реакция кровообращения и дыхания на внезапную десимпатизацию и/или блокаду опиоидных рецепторов — штука столь же индивидуальная, как и форма носа, голос и походка & СА всегда ставит перед вегетативной системой сложнейшую задачу и требует немедленного на нее ответа. В случаях, когда ответ оказывается неудачным, мы имеем дело с осложнением. Судя по некоторым статистикам, существует контингент больных (ок. 5 — 9% от общего числа), у которых развитие гипотонии и/или брадикардии при использовании любых существующих подходов к профилактике является непредотвратимым & Было бы хорошо иметь в распоряжении скрининговый метод определения адаптационных способностей организма, который позволил бы предсказывать реакцию пациентов на СА и в определенных случаях заведомо отказываться от этого способа обезболивания. Мне кажется, что наиболее перспективным в этом отношении является метод вариационного анализа сердечного ритма.

В-шестых, при СА различные изменения в состоянии организма («anaesthesia-related events» британских авторов) — от совершенно безобидных отклонений до грозных осложнений — могут возникать на любом этапе: в начале, в середине или в конце операции и даже в течение первых часов послеоперационного периода. Выводы напрашиваются сами.

И все-таки,


  • исключительное качество обезболивания,

  • безупречная релаксация,

  • отчетливое уменьшение кровопотери

  • неизменно высокие баллы Апгар,

  • превосходные отзывы оперированных женщин,

  • совершенно иное качество здоровья пациентки в течение первых суток послеоперационного периода,

  • «штучная», «ручная» работа анестезиолога в отличие от «наркозного конвейера»

превращают спинальную анестезию при кесаревых сечениях в мощный магнит для желающих работать лучше и интереснее.

И наконец, главное. СА не является тем методом, который может лежать в запасе и применяться лишь от случая к случаю. К спинальной анестезии в полной мере относится старая истина о том, что человек хорошо делает то, что делает часто. Приступать к освоению этого метода имеет смысл, лишь если есть возможность и твердое намерение поставить его на конвейер. Следует заметить, что в акушерстве такое намерение может быть осуществлено без особого напряжения. Огромный опыт наших зарубежных коллег и практика отдельных отечественных медицинских учреждений свидетельствуют, что 40 — 70% от общего количества кесаревых сечений могут быть выполнены в условиях СА по нормальным, не натянутым и не гипертрофированным показаниям.

Именно так, естественным и спокойным способом, без рывков, и не впадая в крайности, следует вносить радикальные изменения в структуру методов обезболивания при операции КС. А необходимость в таких изменениях назрела уже давно, и очень жаль, что этого не понимают те, чьей прямой обязанностью является анализ причин материнской и перинатальной смертности, уровень которых не оставляет сомнений о принадлежности нашей страны к третьему миру.

Каждый метод, будь то эпидуральная, спинальная или общая анестезия, должен иметь свою нишу. Чем шире спектр методов обезболивания, которыми в совершенстве владеет анестезиолог, тем сложнее поставить этого специалиста в затруднительное или безвыходное положение.

Часть 2.
ПОКАЗАНИЯ И ПРОТИВОПОКАЗАНИЯ. СОГЛАСИЕ БОЛЬНОЙ


Достарыңызбен бөлісу:

Отделение анестезиологии, реаниматологии и интенсивной терапии взрослых

Отделение состоит из трёх блоков: анестезиологического, реанимационного и интенсивного.

В отделении оказывается помощь мамам.

Основные направления работы отделения – анестезия при оперативном родоразрешении, обезболивание родов, анестезиологическое обеспечение операций в гинекологии, в том числе лапароскопических и гистероскопических.

Беременные с тяжёлыми осложнениями также госпитализируются в отделение анестезиологии, реаниматологии и интенсивной терапии (АРиИТ).

Отделение укомплектовано современным оборудованием и имеет в своём арсенале самые передовые лекарственные препараты для проведения анестезии и реанимационных мероприятий.

Сотрудники отделения владеют всеми современными методиками анестезии:

  • тотальная внутривенная анестезия с использованием искусственной вентиляцией легких;
  • спинномозговая;
  • эпидуральная;
  • комбинированная спинально-эпидуральная анестезия;
  • сочетанная анестезия;
  • периферические регионарные блокады (паравертебральная блокада).

 

Все виды анестезии ежедневно применяются в повседневной практике, строго учитываются все показания и противопоказания данных методов

Врачи анестезиологи-реаниматологи отделения АРиИТ взрослых проводят плановые и экстренные анестезии и оказывают круглосуточную неотложную помощь в 3-х операционных, оснащённых современной дыхательной и следящей аппаратурой, используя современные медицинские технологии, методики поддержания постоянного температурного режима пациента и т.п. В отделении имеется собственный Банк препаратов крови.

Если Вам предстоит операция…

Возможно, произойдёт так, что Вам будет необходима операция кесарева сечения. Не переживайте и помните, что самая главная для нас цель – это безопасность для Вас и Вашего ребенка. Бывают ситуации, когда именно кесарево сечение является наилучшим средством для достижения безопасности.

Существует несколько видов анестезии при операции кесарева сечения. Мы постараемся донести до Вас суть этих процедур. Кроме того, Вы можете обсудить выбор анестезии с Вашим анестезиологом.

Если Ваша операция кесарева сечения запланирована заранее. Это называется плановое кесарево сечение. Операция может быть рекомендована, если имеется повышенная вероятность развития осложнений при проведении родов естественным путём, как для Вас, так и для новорожденного.

В других случаях операция кесарева сечения выполняется по срочным показаниям, обычно уже в процессе родов. Это так называемое экстренное кесарево сечение.

Врач акушер-гинеколог обсудит с Вами причины, по которым требуется кесарево сечение и спросит Ваше согласие на вмешательство.

Возможны два основных вида анестезии во время операции кесарева сечения:

  1. Регионарная (спинномозговая или эпидуральная) анестезия.
  2. Общая анестезия.

Главное отличие этих методов в том, что при регионарных методах анестезии роженица бодрствует и может сразу контактировать с новорожденным, при этом нижняя половина её тела, включая живот, становится нечувствительной к боли.

При наличии противопоказаний к регионарным методам анестезии Вам будет проведения общая анестезия. При этом виде обезболивания Вы засыпаете с самого начала операции и пробуждаетесь уже в отделении АРиИТ.

Если Вам предстоят естественные роды…

Наш Центр может предложить Вам несколько видов обезболивания.

   Сложно предсказать какой вид обезболивания окажется для Вас лучшим, но после беседы с нашим специалистом, будет подобран самый оптимальный метод. Проконсультироваться с анестезиологом-реаниматологом можно заблаговременно.

  Пациентка имеет право на выбор врача по взаимному предварительному согласованию.

   Хотим Вам немного рассказать о методах обезболивания, которые Вам могут быть предложены.

  1. Инъекционные средства (наркотические анальгетики)
  2. Спинномозговая анальгезия.
  3. Паравертебральная блокада.
  4. Эпидуральная анестезия.

Инъекционные средства.

При невозможности проведения регионарных методов анальгезии и периферических блокад, при наличии противопоказаний к ним, внутривенное введение наркотических анальгетиков – это единственный способ незначительно облегчить боль.

Преимущества:

  • Технически самый простой и быстрый способ введения анальгетика.
  • Предельно низкая вероятность развития анафилаксии.

 Недостатки:

  • Может вызвать наркодепрессию новорожденного, если анальгетики введены менее чем за 2 часа до предполагаемого момента родов.
  • Недостаточной мощности анальгезирующий эффект для роженицы и, к сожалению, очень кратковременный.
  • Возможно возникновение таких побочных эффектов у роженицы, как сонливость, рвота и сильное головокружение.

Спинномозговая анальгезия.

Преимущества:

  • Не оказывает влияние на новорожденного
  • Технически проще и быстрее выполняется, чем эпидуральная анальгезия.
  • Отличный обезболивающий эффект

 Недостатки:

  • Длительность эффекта 2-3 часа. Чаще всего этого достаточно, чтобы шейка матки раскрылась полностью и Ваши мышцы брюшного пресса были готовы к полноценной работ во время потужного периода.
  • Постпункционная головная боль. Возникает реже, чем у 1 пациентки из 500. При своевременном лечении проходит в течение 1-2 дней.
  • Риск анафилаксии минимален, но возможен, как при любом применении местных анестетиков.

Адаптировано с сайта «Школа регионарной анестезии»

Паравертебральная блокада.

Преимущества:

  • Не оказывает негативного влияния на плод.
  • Обеспечивает стабильность гемодинамики роженицы на протяжении как первого, так и второго периода родов.
  • Отсутствует риск развития моторной блокады нижних конечностей – Вы можете сохранять умеренную активность, т.е. ходить, если возникнет такое желание.
  • Отсутствие отрицательного влияния в потужном периоде (который возможен при эпидуральной анестезии) сохраняет Ваш контроль над схватками.

Недостатки:

  • Очень редко, но возможен недостаточный анальгезирующий эффект.
  • Риск анафилаксии минимален, но возможен, как при любом применении местных анестетиков
  • Длительность эффекта 3-4 часа.

Адаптировано с сайта «Школа регионарной анестезии»

Эпидуральная анестезия.

Преимущества:

  • Не оказывается влияния на новорожденного
  • Обычно дает отличный обезболивающий эффект.

Недостатки:

  • При повторных дозах местного анестетика сильной концентрации, может возникнуть временное онемение и слабость (в ногах).
  • Эпидуральная блокада может замедлить вторую стадию родов (потужной период).
  • Ваше артериальное давление может снизиться (1 случай из 50), также могут возникнуть зуд и повыситься температура.
  • Место установления эпидурального катетера в течение нескольких дней может оставаться болезненным. Длительная боль в спине – это распространенное явление после беременности, она НЕ вызывается эпидуральной блокадой!
  • Недостаточный анальгезирующий эффект. В 1 случае из 8 требуется проведение других методов обезболивания.
  • Головная боль у 1 пациентки из 100.
  • Повреждение нервов (участок онемения на ноге или стопе или мышечная слабость в ногах) временное явление – возникает у одной пациентки 1 на 1000 родильниц.
  • Повреждение нервов, сохраняющееся в течение более 6 месяцев – 1 на 13000 родильниц.
  • Гематома (кровоизлияние) эпидурального пространства – 1 на 170000 родильниц.

Представленные цифровые данные не дают точных значений для всех осложнений.

Адаптировано с сайта Ассоциации Акушерских Анестезиологов Obstetric AnaesthetistsAssociation 

departments::index.workIn

Исаева Элеонора Владимировна
Заведующая отделением, врач анестезиолог-реаниматолог, ургентный врач

Алыкеева Гульнара Маликовна
Врач анестезиолог-реаниматолог

Гиберт Полина Витальевна
Врач анестезиолог-реаниматолог

Симашова Анжела Руслановна
Врач анестезиолог-реаниматолог

Канаева Динара Адылбековна
Старшая медсестра отделения

Шкурина Екатерина Валерьевна
врач акушер-гинеколог

Влияние объема преинфузии на состояние гемодинамики при проведении спинномозговой анестезии для обезболивания операции кесарева сечения

Статья опубликована на с. 162-165

Спинальная анестезия широко используется в акушерстве и на сегодняшний день в странах Европейского союза является самым популярным методом обезболивания плановых операций кесарева сечения. Этому закономерному явлению есть целый ряд объяснений. Регионарные методы обез–боливания в отличие от общей анестезии обеспечивают максимальную антиноцицептивную защиту организма и эффективно предотвращают операционный стресс. По сравнению с общей анестезией при спинномозговой возрастает маточно–плацентарный и почечный кровоток, снижается к минимуму уровень катехоламинов в кровеносном русле беременной, становится полезным и гипотензивный эффект симпатической блокады (уменьшение кровопотери), а также сводится практически к нулю риск аспирационных осложнений [1, 7]. Согласно опубликованным данным, смертность акушерских пациентов при общей анестезии превышает таковую при регионарной анестезии в 17 раз [6].

Несмотря на такое широкое распространение регионарных методов анестезии, артериальная гипотония во время спинальной анестезии до сих пор остается серьезной проблемой. Безусловно, профилактика этого осложнения значительно выгоднее во всех отношениях, чем его лечение. Поэтому в течение многих лет с целью предупреждения гипотонии используется внутривенная преинфузия до начала спинальной анестезии. Однако, несмотря на все меры профилактики, частота возникновения артериальной гипотензии все еще остается высокой.

Смещение матки влево и агрессивная внутривенная преинфузия долгое время являлись основными, не подлежащими критике и пересмотру рекомендуемыми постулатами для профилактики артериальной гипотонии во время кесарева сечения при спинальной анестезии. И если полезность и эффективность смещения матки влево были хорошо доказаны всем опытом акушерской анестезиологии, то более современные исследования не сумели продемонстрировать эффективность преинфузии в предотвращении артериальной гипотонии [8, 9, 11].

В большинстве рекомендаций озвучивается необходимость преинфузии в объемах 1000–1500 мл за 10, 20, 30 мин непосредственно перед спинномозговой анестезией (СМА). Многочисленными исследованиями последних лет было выявлено, что преинфузия растворов кристаллоидов в объемах от 250 мл до 2 л действительно временно увеличивает предварительную нагрузку и часто улучшает функциональное состояние сердца, но без последовательного в дальнейшем увеличения внутриартериального кровяного давления или предотвращения гипотонии [2, 13, 17]. Более того, кристаллоидные растворы быстро перераспределяются из внутрисосудистого во внесосудистое пространство, это нивелирует все ожидания в плане профилактики гемодинамических сдвигов во время спинномозговой анестезии [16].

Некоторые авторы полностью отказались от преинфузии и сделали ставку только на вазопрессорную терапию непосредственно во время операции [8]. Таким образом, вопрос об объеме преинфузии остается до сих пор открытым.

Цель исследования: сравнительная оценка эффективности разных программ преинфузии для профилактики развития артериальной гипотензии при операции кесарева сечения, проводившегося под спинномозговой анестезией.

Материалы и методы

Нами проведен ретроспективный анализ 136 историй родов пациенток, которые были родоразрешены в Киевском областном центре охраны здоровья матери и ребенка путем операции кесарева сечения, проводившегося под спинномозговой анестезией, за период 2004–2014 гг.

В исследование не вошли пациентки: с осложненным течением беременности (преэклампсия любой степени), артериальной гипертензией, патологией сердца, многоплодной беременностью, сроком беременности до 36 недель и систолическим артериальным давлением (АД) до операции 100 мм рт.ст. и ниже.

Премедикация зависела от экстренности операции: плановые операции — за 20 минут до операции атропин (0,1 мг на 10 кг массы) внутримышечно; экстренные операции — атропин 0,5 мг внутривенно в операционной. В преинфузии использовались только кристаллоидные растворы (NaCl 0,9%), она проводилась за 10–20 минут до пункции субарахноидального пространства. Объем инфузионной программы после субарахноидальной пункции был одинаковым. Для достижения спинномозгового блока использовался гипербарический 0,5% бупивакаин в дозе 12,5–15 мг (в зависимости от роста пациентки), адъюванты не применялись. Пункции выполняли на уровне L2–L3 спинномозговой иглой G25, в положении пациентки лежа на правом боку. Спинномозговой блок развивался через 5–7 минут после пункции. Анестезия была адекватной и не требовала применения дополнительного обез–боливания. Для профилактики синдрома аортокавальной компрессии в горизонтальном положении пациентки под правую ягодицу укладывался валик. Артериальная гипотензия расценивалась как снижение систолического артериального давления менее 100 мм рт.ст. или снижение исходного систолического артериального давления больше чем на 20 % [3, 14]. Коррекция артериального давления проводилась раствором 0,01% фенилэфрина гидрохлорида (в разведении 0,2 мл 1% раствора фенилэфрина на 20 мл NaCl 0,9%), титрованно по 0,5–1 мл разведенного раствора. Во время анестезии проводились: стандартный мониторинг показателей артериального давления, частоты сердечных сокращений, насыщения гемоглобина артериальной крови кислородом монитором ЮТАС ЮМ–300 (Украина). Измеряли АД через каждые 2 мин до извлечения плода и в последующем через каждые 5 мин до перевода родильницы в отделение интенсивной терапии.

Полученные данные вносились в специально разработанную форму, статистический анализ проводился с помощью программы Microsoft Оffice excel 2007. Распределение результатов исследования соответствовало нормальному закону распределения, поэтому для статистического анализа данных использовался двусторонний непарный критерий Стьюдента (t), критическое значение которого (tкр.) соответствовало числу степеней свободы и бралось из справочных таблиц. При проведении статистических расчетов уровень значимости (a) соответствовал 0,05 [15].

Ход исследования. В зависимости от объема кристаллоидных растворов, входивших в преинфузию, проводившуюся в условиях операционной, все истории родов были разделены на две группы. В первой группе (n1 = 99 чел.) преинфузия проводилась в объеме 400 мл NaCl 0,9% (5 мл/кг), во второй группе (n2 = 37 чел.) — в объеме 800 мл NaCl 0,9% (10 мл/кг). Основные средние данные пациенток обеих групп приведены в табл. 1.

Истории родов были сопоставимы по возрасту, весу, росту, индексу массы тела, кровопотере, оценке по шкале ASA, количеству беременностей и сроку беременности.

В данных группах анализировались изменения АД пациенток после начала спинномозговой анестезии, регистрировали частоту возникновения артериальной гипотензии. Полученные результаты приводятся в табл. 2.

Пациентки в обеих группах были сопоставимы по уровню сенсорного блока и исходному АД. Частота возникновения и уровень снижения АД были больше во второй группе, где объем преинфузии составлял 800 мл (n2 = 37).

Уровень снижения АД и дозы фенилэфрина гидрохлорида, которые потребовались для коррекции артериальной гипотензии, представлены в табл. 3.

Уровень снижения АД и дозы использованного фенилэфрина были больше во второй группе, где объем преинфузии составлял 800 мл (n2 = 37).

Результаты и их обсуждение

Согласно полученным результатам, во второй группе (где преинфузия проводилась в объеме 800 мл NaCl 0,9% — 10 мл/кг) артериальная гипотензия встречалась чаще, степень снижения артериального давления и дозы фенилэфрина, использованного для коррекции артериального давления, были больше, чем в первой группе (где преинфузия проводилась в объеме 400 мл NaCl 0,9% — 5 мл/кг). Данные отличия были статистически значимые. Полученные результаты могут быть объяснены тем, что использование больших объемов является довольно агрессивным вмешательством по отношению к системе кровообращения и может вызывать увеличение внутрипредсердного давления и растяжение миокарда предсердий, что является основным стимулом для секреции предсердного натрийуретического пептида. Данный пептид не только может вызывать усиление диуреза, но и сам является вазодилататором [10].

В дополнение к этому большие объемы кристаллоидных растворов снижают вязкость крови, что, в свою очередь, тоже несколько снижает артериальное давление и может предрасполагать к артериальной гипотонии вследствие усиления перехода жидкости в интерстициальное пространство и ткани. Снижение гематокрита, вызванное большими дозами кристаллоидов, снижает способность крови матери переносить кислород. В совокупности с артериальной гипотонией этот фактор может оказать критическое воздействие на доставку кислорода к плоду [10].

Выводы

1. Преинфузия при спинномозговой анестезии во время операции кесарева сечения полностью не снижает риск возникновения артериальной гипотензии.

2. Более эффективной в плане профилактики развития артериальной гипотензии при операции кесарева сечения, проводившегося под спинномозговой анестезией, является преинфузия в объеме до 5 мл/кг кристаллоидных растворов, введенных за 10–20 минут до пункции субарахноидального пространства.

3. Увеличение объема преинфузии способствует повышению частоты возникновения и тяжести артериальной гипотензии во время спинномозговой анестезии при операции кесарева сечения.

Полученные результаты дают возможность пересмотреть существующие методические рекомендации, направленные на уменьшение частоты артериальной гипотензии во время спинномозговой анестезии при операции кесарева сечения.

Bibliography

1. Шурыгин И.А. Спинальная анестезия при кесаревом сечении. — СПб.: Диалект, 2004. — 192 с.

2. Arndt J.O. et al. Incidence and time course of cardiovascular side effects during spinal anesthesia after prophylactic administration of intravenous fluids or vasoconstrictors // Anesth. Analg. — 1998. — Vol. 87. — P. 347–354.

3. Birnbach D.J. Ostheimer’s Manual of Obstetric Anesthesia. — 3rd edition. — Churchill Livingstone. — 2000.

4. Buggy D. et al. Prevention of spinal anesthesia–induced hypotension in the elderly: Comparison between preanesthetic administration of crystalloids, colloids, and no prehydration // Anesth. Analg. — 1997. — Vol. 84. — P. 106–110.

5. Critchley L.A., Conway F. Hypotension during subarachnoid anaesthesia: haemodynamic effects of colloid and metaraminol // Br. J. Anaesth. — 1996. — Vol. 76. — P. 734–736.

6. Hawkins J.L., Koonin L.M., Palmer S.K. et al. Anesthesia–related deaths during obstetric delivery in the United States, 1979–1990 // Anesthesiology. — 1997. — Vol. 86. — P. 277–284.

7. Husaini S.W., RusselI. F. Volume preload: lack of effect in the prevention of spinal–induced hypotension at cesarean section // International Journal of Obstetric Anesthesia. — 1998. — Vol. 7. — P. 76–81.

8. Jackson R., Reid J., Thorburn J. Volume preloading is not essential to prevent spinal–induced hypotension at caesarean section // Br. J. Anaesth. — 1995. — Vol. 75. — P. 262–265.

9. Park G.E. et al. The effects of varying volumes of crystalloid administration before cesarean delivery on maternal hemodynamics and colloid osmotic pressure // Anesth. Analg. — 1996. — Vol. 83. — P. 299–303.

10. Pouta A.M., Karinen J., Vuolteenaho O.J. et al. Effect of intravenous fluid preload on vasoactive peptide secretion during caesarean section under spinal anaesthesia // Anaesthesia. — 1996. — Vol. 51. — P. 128–132.

11. Rout C., Akoojee S.S., Rocke D.A. Rapid administration of crystalloid preload does not decrease the incidence of hypotension after spinal anaesthesia for elective caesarean section // Br. J. Anaesth. — 1992. — Vol. 68. — P. 394–397.

12. Rout C., Rocke D.A. Spinal hypotension associated with Cesarean section. Will preload ever work? // Anesthesiology. — 1999. — Vol. 91. — P. 1565–1567.

13. Sharma S.K., Gajraj N.M., Sidawi J.E. Prevention of hypotension during spinal anesthesia: A comparison of intravascular administration of hetastarch versus lactated Ringer’s solution // Anesth. Analg. — 1997. — Vol. 84. — P. 111–114.

14. Shnider S.M., Levinson G. Anesthesia for Obstetrics. — 3rd edition. — Williams & Wilkins, 1993. — 400 p.

15. Stanton A. Primer of biostatistics fourth edition. — М.: Практика, 1999. — 462 с.

16. Svensen C., Hahn R.G. Volume kinetics of Ringer solution, dextran 70, and hypertonic saline in male volunteers // Anesthesio–logy. — 1997. — Vol. 87. — P. 204–212.

17. Ueyama H. et al. Effects of crystalloid and colloid preload on blood volume in the parturient undergoing spinal anesthesia for elective Cesarean section // Anesthesiology. — 1999. — Vol. 91. — P. 1571–1576.

последствия, сколько по времени длится операция с эпидуральной анестезией, почему болит спина после процедуры, отзывы

Подавляющее большинство операций кесарева сечения в России сегодня выполняется с применением эпидуральной анестезии. Она позволяет женщине сохранять ясное сознание в течение всего периода хирургических манипуляций и при этом не ощущать боли. Главное, что дает такой вид наркоза – возможность увидеть момент рождения крохи, порадоваться его первому вдоху и первому крику. Эти минуты поистине бесценны. В данном материале мы расскажем о том, как делается эпидуральный наркоз, какое действие он имеет, какие осложнения после него могут развиться и есть ли альтернативы.

Что это такое?

Эпидуральная анестезия относится к разряду современных бережных методов наркоза. В медицине существует второе название – перидуральная анестезия, а женщины и врачи в повседневности частенько называют ее «эпидуралка». При кесаревом сечении данный метод обезболивания получил широкое применение в последние годы. В позвоночнике человека сосредоточено большое скопление нервов, а потому введение анестетиков непосредственно в позвоночник позволяет добиться узких поставленных целей – обезболить ту или иную часть тела для последующих хирургических действий.

Эпидуральная анестезия подразумевает «доставку» посредством тонкого катетера лекарственных препаратов в эпидуральное пространство позвоночника. Анестетик попадает в промежуток между стенками позвоночника и плеврой спинного мозга. Корешки нервов омываются анестетиком и перестают передавать нервные импульсы головному мозгу. В центр боли в головном мозге, таким образом, не поступает информации о чувствительности в блокированной части тела, а значит, любые манипуляции в этой части допустимы, и пациентке не будет больно.

Эпидуральное обезболивание используется и при естественных родах, и при кесаревом сечении. Но в первом случае вводятся небольшие дозы анальгетиков, например, лидокаина или ропивакаина. Они позволяют добиться частичного обезболивания с сохранением чувствительности нижней части тела.

При кесаревом сечении, которое подразумевает проникновение внутрь брюшной полости, требуется более длительное и глубокое блокирование болевых ощущений. Поэтому к анальгетикам добавляют опиаты – бупренофрин, промедол и т. д. Может применяться кетамин.

Все растворы проходят предварительную фармакологическую очистку, они предназначены исключительно для спинального или эпидурального введения. При попадании в зону корешков нервов в эпидуральном пространстве позвоночника лекарства действуют сильнее и дольше, а потому сами по себе дозы используются меньшие, чем при внутривенном наркозе.

Какую дозу вводить той или иной женщине, решает специалист-анестезиолог на основании анализов, общего состояния здоровья будущей мамы, ее веса и роста. Причем именно рост в этом случае имеет решающее значение: на каждый сегмент позвоночника, который нужно обезболить, в среднем применяют по 2 мл раствора. Описание методик расчета доз довольно сложное, врачи пользуются особыми алгоритмами и формулами.

Как проводится?

Кесарево сечение в среднем длится от 20 до 40 минут. С эпидуральной анестезией оно длится чуть дольше. Дополнительное время требуется для того, чтобы постепенно, поэтапно, правильно и точно обезболить поясничный отдел позвоночника, который нужно блокировать, чтобы временно исчезла чувствительность в области брюшной полости и паха.

Перед тем как обезболить, анестезиолог должен убедиться в том, что пациентка чувствует себя хорошо. Для этого измеряют давление, температуру, частоту пульса, обязательно смотрят свежие результаты анализа крови. Женщине крепят манжету, которая в прямом режиме будет сама контролировать уровень кровяного давления, частоту пульса.

Роженицу укладывают на операционный стол так, чтобы она находилась на боку, голову просят наклонить как можно ниже. Спина, таким образом, округляется, позвонки лучше проступают через кожные покровы, что облегчает врачу поиск места для введения катетера. Анестезиолог проводит разметку специальным карандашом прямо на спине пациентки и приступает к введению катетера.

Кожные покровы тщательно дезинфицируют. Далее иглу вводят через желтую связку между необходимыми позвонками. Методов для проверки правильности введения существует несколько. Врач может ориентироваться на попадание в иглу спинномозговой жидкости, а может воспользоваться шприцем с воздухом, присоединенным к катетеру. Если поршень будет встречать сопротивление, то катетер все еще пребывает в связке, если же сопротивление исчезает, это является признаком попадания в эпидуральное пространство.

После того как анестезиолог попал в нужное место, он вводит первую дозу, которая называется тест-дозой. Оценка состояния занимает около трех минут. После чего остальная часть положенного женщине лекарственного раствора вводится постепенно, поэтапно и медленно, поддержка растягивается настолько, сколько по времени потребуется хирургам для завершения операции.

После тест-дозы обычно достичь обезболивания, необходимого для начала операции, удается в течение 10-15 минут. За состоянием женщины внимательно наблюдают и по необходимости могут добавить новую дозу препаратов. Когда малыш появился на свет, а швы (внутренние и внешние) наложены, катетер извлекают. Женщину переводят в палату интенсивной терапии для наблюдения за ней в период выхода из наркоза.

Проходит операция, как уже говорилось, при полном сознании пациентки. Чтобы она не видела манипуляций хирургов, перед лицом ставят ширму, а когда появится малыш, его обязательно показывают маме и могут оставить рядом с ней, пока идет вторая фаза оперативного вмешательства, в ходе которой хирург вручную вынимает плаценту и накладывает швы.

Плюсы и минусы, возможные последствия

Такое обезболивание считается одним из самых безопасных, но совершенно безопасным назвать «эпидуралку» нельзя.

  • В 1 случае на 50 тысяч родов встречаются различные осложнения. Примерно в 17% случаев после введения лекарства в эпидуральный канал не удается добиться полной блокады. У женщины сохраняется в той или иной степени чувствительность, что нежелательно ни для роженицы, ни для хирурга, которому хотелось бы проводить операцию пациентке расслабленной, не напрягающей мышц.
  • Если у будущей мамы существуют проблемы со свертываемостью крови, то в месте прокола может развиться гематома, а в церебральную жидкость может попасть кровь.
  • Многое зависит от квалификации и опыта самого анестезиолога. Неумелые или небрежные действия при введении иглы могут привести к травмированию твердой спинномозговой оболочки. Это нередко опасно утечкой спинномозговой жидкости, что может привести к развитию тяжелых головных болей, а также нарушениям нормальной работы центральной нервной системы.
  • Если будет травмировано субарахноидальное пространство, последствия могут быть более тяжелыми – судороги, спазмы, потеря сознания, паралич нижних конечностей.
  • Достаточно часто можно услышать мнение, что эпидуральная анестезия не вредит ребенку, в отличие от общего наркоза. Это не совсем так. Не исключены развитие слабости дыхательной деятельности, возникновение послеродовой гипоксии, нарушение сердечного ритма под воздействием медикаментов у плода уже после рождения.

Выход из наркоза, осуществленного через эпидуральное пространство, занимает около 2 часов. Чувствительность нижней части тела возвращается постепенно, вместе с этим приходит боль. Ее купируют уколами обезболивающих препаратов внутримышечно. Одновременно вводят сокращающие матку препараты, например, окситоцин. И в этом восстановительный период мало чем отличается от аналогичного периода после общего наркоза.

При эпидуральном обезболивании состояние женщины остается более стабильным – сосуды и сердце работают без перебоев. Существенный минус метода – психологическая неготовность многих рожениц «присутствовать» на собственной операции. Это пугает, понимание того, что именно сейчас происходит, может вызывать резкое отторжение.

Если блокированы не все нервные окончания, то женщина будет ощущать ограниченный спектр неприятных моментов, но резкой боли она чувствовать не будет.

Противопоказания

Женщины имеют законодательное право на выбор метода анестезии при проведении кесарева сечения. Если, несмотря на все достоинства регионарной анестезии, женщина твердо нацелена на общий наркоз, будет достаточно только написать соответствующий отказ от эпидуральной анестезии. Противопоказаний общий наркоз не имеет. Если же женщина, наоборот, хочет принять самое деятельное и непосредственное участие в происходящем и настаивает на эпидуральной анестезии, врач не всегда может позволить это, поскольку у метода есть определенные ограничения.

  • При тяжелом гестозе или ожирении, травмах или деформации позвоночника, системных инфекциях, местном воспалительном процессе на коже в области предполагаемого введения иглы катетера, аллергии на медикаменты, используемые при таком обезболивании, поражениях ЦНС и низком давлении, подозрении на кровотечение или открывшемся кровотечении, в проведении эпидуральной анестезии отказывают.
  • Не рассматривается вопрос эпидуральной анестезии и при экстренном кесаревом сечении, если есть необходимость извлечь малыша из материнской утробы как можно скорее.

Если кесарево сечение подразумевает удаление матки после рождения малыша по медицинским показаниям, также будет рекомендован исключительно общий наркоз.

Альтернатива

Основной альтернативой эпидуральной анестезии на сегодня является общий (эндотрахеальный наркоз). При нем препараты вводятся внутривенно, а после засыпания женщины и введения трубки в трахею, пациентку подключают к аппарату искусственной вентиляции легких и начинают оперировать. Во время операции женщина находится без сознания, качество наркоза – выше эпидурального, любая чувствительность во время хирургических манипуляций полностью исключается.

Воздействие препаратов на малыша не исключено, при этом подавляется и его центральная нервная система. Но вероятность тяжелых последствий и осложнений невелика. Многие женщины слышали о том, что существует еще и спинальная анестезия. Она является разновидностью эпидуральной, только отличия кроются в глубине введения лекарственных препаратов в позвоночник. Эпидуральная отличается от спинальной менее глубокой блокадой.

Люмбальная пункция происходит не в эпидуральное, а в субарахноидальное пространство позвоночника. Спинальная или спинномозговая анестезия проводится более тонкой иглой, а доз обезболивающих препаратов требуется несколько меньше, чем при эпидуральном наркозе. Эффект при спинальном обезболивании наступает значительно быстрее, почти сразу после введения медикаментов. В остальном эпидуральная и спинномозговая анестезия почти что одинаковы.

Отзывы пациенток

Многие женщины отмечают, что после «эпидуралки» сильно болит спина, причем боли не проходят даже после выписки из родильного дома и сохраняются еще несколько недель. Женщины, которые делали не одно кесарево сечение с разным обезболиванием, утверждают, что после эпидуральной анестезии процесс выхода из наркоза протекает легче.

На головные боли, которые стартуют после операции и могут продолжаться довольно долго, жалуется около трети рожениц. Есть в интернете и отзывы тех, на кого такой наркоз подействовал «неправильно»: было ощущение онемения ног, но брюшная стенка сохраняла чувствительность. Таким роженицам пришлось в последний момент делать общий наркоз, чтобы не вызвать болевого шока.

Почти все мамочки утверждают, что эпидуральное обезболивание – это страшно само по себе. А потом еще более получаса лежать на операционном столе, слушая разговоры врачей и стук инструментов, – это слишком тяжело для психики.

Но момент рождения малыша, который никогда не увидишь под общим наркозом, не забывается. Зачастую ради него одного можно потерпеть все остальные страхи и неудобства.

О методах обезболивания при кесаревом сечении смотрите в следующем видео.

Анестезия при кесаревом сечении — презентация онлайн

1. КАРАГАНДИНСКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ КАФЕДРА АНЕСТЕЗИОЛОГИИ И РЕАНИМАЦИИ

Анестезия при кесаревом сечении.
Выполнил: Тажиева Ж.Х.
6002 АиГ
Принял:
• Когда можно применять спинальную анестезию при кесаревом
сечении
• Рассмотрим местные (регионарные) способы анестезии. Их два,
спинномозговая и эпидуральная анестезия. При обоих видах
анестетик вводится в поясничную область. Главное отличие
одного вида от другого в том, на какую глубину выполняется
прокол, и какое количество анестезирующего вещества
вводится. При местном (регионарном) обезболивании
«отключается» нижняя часть тела женщины, и она при этом
находится в сознании.
• Подробнее об операции можно посмотреть в статье Ход
операции кесарева сечения.
• Спинальная (спинномозговая) анестезия может выполняться
при плановом кесаревом, и иногда и при экстренном, в том
случае, если у врачей есть «в запасе» 10-15 минут.
• Как выполняется спинальная анестезия при кесаревом сечении
• Женщина принимает такое положение, чтобы был обеспечен
доступ к позвоночнику. Это либо положение сидя со
спущенными ногами, либо положение лежа на боку и выгнутой
спиной.
• Дезинфицируют область вокруг предстоящего прокола.
• Делают обезболивающий укол, чтобы кожа и подкожный слой
потеряли чувствительность и прокол не был болезненным.
• Специальной длинной и тонкой иглой вводят анестетик в
спинномозговую жидкость.
• Вынимают иглу, место прокола закрывается стерильной
салфеткой.

Плюсы спинальной анестезии при кесаревом сечении
Анестезирующие препараты, применяемые для спинальной анестезии, не воздействуют на
ребенка.
Быстрое действие анестетика. Это важно, так как с началом действия лекарства давление в
нижней части тела женщины падает (а это ведет к кислородному голоданию плода). И
поэтому важно, чтобы ребенок был извлечен как можно быстрее после введения анестетика.
Нужна меньшая доза анестетика (в сравнении с эпидуральной анестезией), и поэтому ниже
риск токсического отравления при случайном попадании анестетика в кровь.
Мышцы тела роженицы полностью расслаблены, это удобно для работы хирурга (так же как и
при общем наркозе).
Так как роженица пребывает в сознании, то уменьшается риск возникновения проблем с
дыханием. В крайнем случае можно применить кислородную маску.
Для успешной спинальной анестезии нужно меньшее мастерство анестезиолога, чем для
эпидуральной. То есть: самое простое, — это общий наркоз, потом спинальная , потом
эпидуральная анестезии. Выделять по сложности виды анестезии не правильно, т.к все
зависит от мастерства анестезиолога, а также от клинической ситуации, состояния
беременной и ее анатомических особенностей
При спинальной анестезии женщина сразу слышит первый крик своего ребенка, и может
сразу приложить его к груди.
• Минусы, осложнения спинальной анестезии при кесаревом сечении
• При введении анестетика резко падает артериальное давление у
роженицы. Поэтому, до операции его искусственно поднимают. И,
соответственно, давление поднимается и у ребенка. Это может дать
негативные последствия для нервной системы ребенка.
• Часто отмечены осложнения в виде головных болей.
• При общем наркозе и при эпидуральной анестезии в любой момент
можно добавить дозу лекарства. А в случае спинальной анестезии
доза лекарства единоразовая. Таким образом, если операция по
каким-то причинам осложняется или затягивается, роженицу введут в
общий наркоз. Современные препараты для спинальной анестезии
рассчитаны на срок 40- 60 минут до 2-х часов. Как правило, этого с
запасом хватает для проведения операции.

Ниже перечислены возможные осложнения для мамы и ребенка после
местной (регионарной) анестезии. Перечисленные ниже осложнения
касаются и спинальной, и эпидуральной анестезии.
При проколе, спинномозговая жидкость может попасть в эпидуральное
пространство. Это влечет за собой последствия в виде сильных головных
болей и сильных болей в спине. Лечение, как правило, следующее. На
начальных этапах лечат медикаментозно. Если боли продолжаются, то
выполняют процедуру, «кровяной пломбы». В ходе процедуры в
эпидуральное пространство вводится своя кровь женщины, чтобы она
закрыла прокол в спинномозговой оболочке.
Есть опасность развития синдрома длительного позиционного сдавливания.
Суть в том, что роженица после операции не чувствует ног. И если женщину
перекладывают на кровать, а нога как-то неправильно лягла (подвернулась
немного, например), то возможны негативные последствия. В ногу не
поступает нормально кровь, и это ведет к отекам и шоку. Нужно обязательно
убедиться в том, что Ваши ноги уложили правильно.
• Что касается последствий для ребенка. Самым важным
является риск развития гипоксии (кислородного
голодания). Гипоксия, как уже описано выше, возникает
из-за снижения давления при местной анестезии.
Давление снижается и при эпидуральной (постепенно,
за 20 минут), и при спинальной (резко) анестезии. При
этом ухудшается кровоток в плаценте и это приводит к
гипоксии. Последствия гипоксии, к сожалению, часто не
видны сразу. То есть, при первичном обследовании
новорожденного (оценке по шкале Апгар), могут быть
высокие баллы. А потом, к 2-3 годам, может сказаться
гипоксия. Поэтому, нельзя исключать из возможных
последствий различные неврологические отклонения у
детей.

Как выполняется эпидуральная анестезия при кесаревом сечении
Процесс выполнения эпидуральной анестезии практически повторяет всё, что выполняется
при спинальной анестезии. Действие препаратов развивается постепенно, в течение 20 минут.
Анестезия наступает через 10-15 минут, а к операции можно приступить через 30 минут после
введения препарата. Подробнее об операции можно посмотреть в статье Ход операции
кесарева сечения.
Женщина принимает такое положение, чтобы был обеспечен доступ к позвоночнику. Это
либо положение сидя со спущенными ногами, либо положение лежа на боку с
подведенными ногами и выгнутой спиной.
Дезинфицируют область вокруг предстоящего прокола.
Делают обезболивающий укол, чтобы кожа и подкожный слой потеряли чувствительность и
прокол не был болезненным.
Игла вводится в эпидуральное пространство (промежуток между стенкой позвоночного
канала и твердой стенкой спинного мозга, именно в эту область выходят нервные окончания).
По игле проводится тонкая трубка (катетер).
Катетер остается внутри прокола, игла вынимается. По катетеру поступает анестетик.
• Плюсы эпидуральной анестезии при кесаревом сечении
• В сравнении со спинальной анестезией, снижение
артериального давления происходит не резко, а
постепенно, и его можно поддерживать в норме
профилактическими мерами.
• Можно в любой момент продлить действие анестетиков
(добавить), — это важное преимущество в сравнении со
спинальной анестезией. Также есть возможность
продлить анестезию на послеоперационный период.
• При спинальной анестезии женщина сразу слышит
первый крик своего ребенка, и может сразу приложить
его к груди. См, примечание ниже.
• Минусы, осложнения эпидуральной анестезии при кесаревом
сечении
• Бывают случаи частичного действия эпидуральной анестезии (когда
обезбаливается какая-то одна часть тела, левая или правая).
• Препараты для эпидуральной анестезии воздействуют на ребенка.
• Нужен высокий уровень мастерства анестезиолога, чтобы анестезия
была выполнена правильно.
• Если прокол был выполнен неправильно, и анестетик введен под
паутинную оболочку спинного мозга, то возможна остановка дыхания
у роженицы, и даже остановка сердца.
• При случайном попадании анестетиков в кровь, возможны
осложнения вплоть до летального исхода.
• Время «вступления лекарств в силу» — 20 минут. Если артериальное
давление женщины за это время резко падает, — высокий риск
продолжительной гипоксии плода.
• Когда нельзя применять эпидуральную анестезию
• Противопоказания применения местной
(регионарной) анестезии. Противопоказания
касаются и спинальной, и эпидуральной анестезии.
• Травмы и деформации позвоночника.
• Отказ женщины от данного вида обезболивания.
• Воспаление в области предполагаемого прокола.
• Пониженное артериальное давление у роженицы.
• Внутриутробная гипоксия плода.
• Наличие кровотечения у роженицы.
• Предполагаемое кровотечение у роженицы.

Возможные осложнения при эпидуральной анестезии
Перечисленные ниже осложнения касаются и спинальной, и эпидуральной анестезии.
При проколе, спинномозговая жидкость может попасть в эпидуральное пространство. Это
влечет за собой последствия в виде сильных головных болей и сильных болей в спине.
Лечение, как правило, следующее. На начальных этапах лечат медикаментозно. Если боли
продолжаются, то выполняют процедуру, «кровяной пломбы». В ходе процедуры в
эпидуральное пространство вводится своя кровь женщины, чтобы она закрыла прокол в
спинномозговой оболочке.
Есть опасность развития синдрома длительного позиционного сдавливания. Суть в том, что
роженица после операции не чувствует ног. И если женщину перекладывают на кровать, а
нога как-то неправильно лягла (подвернулась немного, например), то возможны негативные
последствия. В ногу не поступает нормально кровь, и это ведет к отекам и шоку. Нужно
обязательно убедиться в том, что Ваши ноги уложили правильно.
Что касается последствий для ребенка. Самым важным является риск развития гипоксии
(кислородного голодания). Гипоксия, как уже описано выше, возникает из-за снижения
давления при местной анестезии. Давление снижается и при эпидуральной (постепенно, за
20 минут), и при спинальной (резко) анестезии. При этом ухудшается кровоток в плаценте и
это приводит к гипоксии. Последствия гипоксии, к сожалению, часто не видны сразу. То есть,
при первичном обследовании новорожденного (оценке по шкале Апгар), могут быть высокие
баллы. А потом, к 2-3 годам, может сказаться гипоксия, и могут возникнуть различные
неврологические отклонения у детей.

Спасти пациента можно и без боли | ЗДОРОВЬЕ

Ещё в XIX веке бостонский хирург и стоматолог Уильям Мортон открыл секрет безболезненных операций. Первая демонстрация применения эфирного наркоза состоялась 16 октября 1846 года. С тех пор сравнительно молодая наука — анестезиология — семимильными шагами ушла далеко вперёд.

Сегодня в современных больницах, клиниках используют десятки способов обезболивания. Насколько эффективны в применении анестетики нового поколения? Вызывают ли они опасные для здоровья побочные эффекты? Почему курильщику перед операцией положена сигарета? На эти и другие вопросы ответил врач анестезиолог-реаниматолог Максим Выхрестюк

Мечты сбываются

Елена Жукова: — Максим Андреевич, складывается впечатление, что местное обезболивание в XXI веке применяется гораздо чаще. Это так? 

Максим Выхрестюк: — Действительно, регионарная анестезия нашла широкое применение в разных областях медицины — гинекологии, проктологии, акушерстве, травматологии. Сегодня в Европе и США в процессе естественных родов редко обходятся без неё. При этом у роженицы отсутствует боль, но сохраняется двигательная активность, потуги. Сбылась многовековая мечта о безболезненных родах. При операции кесарева сечения чаще применяется спинномозговая анестезия, ведь для молодой матери важен контакт с ребёнком сразу после его рождения.  

Операция в самом разгаре. Фото: Из личного архива / Максима Выхрестюк

— Рассказывали о случае, когда при плановом кесаревом сечении врачам пришлось перейти от спинномозговой анестезии к общему наркозу… 

— Это может быть связано со многими факторами. К примеру, с неэффективностью спинального блока, патологическими состояниями, как у плода, так и у роженицы.

— А бывает так, что пациент под наркозом — не спит, ощущает боль, но не может об этом сказать врачам? Или это больше выдумки, мифы? 

— В истории медицины описаны случаи, когда человек во время операции всё слышал, видел и чувствовал. Вероятность проснуться в наркозе достаточно мала и, по данным исследований, составляет от 0,008% до 0,2%. И причины  этого — недостаточная глубина наркоза, когда пациенту не поступает достаточное количество анестетика. Могу успокоить читателя — на сегодняшний день разработаны технологии, с помощью которых доза препарата находится под контролем. 

— Многие люди больше боятся не столько самой операции, сколько побочных эффектов от наркоза…

— С применением новых анестетиков риски нежелательных эффектов ощутимо снизились. Да, у пациентов встречаются такие осложнения, как тошнота, рвота, послеоперационные кашель и дрожь, при спинномозговых анестезиях — головные боли. Замечено, что осложнения усиливаются у пациентов с повышенным психоэмоциональным фоном. Поэтому не нужно излишне нервничать перед наркозом и анестезией. Важно оставаться спокойным, настраиваться на позитивные мысли.

Безопасно и комфортно

— Могут ли современные методы и препараты облегчить или вовсе устранить побочные эффекты? 

— Анестезиология не стоит на месте. Возьмем, к примеру, ингаляционную анестезию. Преимущество метода в том, что анестетик попадает в лёгкие пациента и там быстро всасывается. Время введения и выхода из наркоза сокращается. Этот вид анестезии часто применяется при длительных многочасовых операциях.  При ингаляционной анестезии сильных побочных эффектов не наблюдается. И, конечно, при этом используются современные препараты. 

Во время операции дыхание контролируется приборами. Фото: Из личного архива / Максима Выхрестюк

— Ставка делается  на дорогостоящие заграничные анестетики? 

— Не только заграница славится своими открытиями в медицине. Допустим, гордость русских учёных — ксенон, он применяется с 90-х годов, и его стоимость очень высока. И всё-таки пока большинство современных анестетиков — зарубежного происхождения, они поступают из стран, где фармацевтические корпорации тратят деньги на их открытия, исследования, внедрение в медицину. 

— Насколько они безопасны? Ведь известно, что Майкл Джексон умер от применения дипривана, а этот препарат применяется довольно часто. 

— В трагическом случае с Джесоном действительно фигурирует диприван. Дело в том, что некоторые внутривенные препараты могут вызвать угнетения дыхания. Их вводят в условиях медицинских учреждений, где есть специальная аппаратура, позволяющая в любой момент перевести пациента на искусственную вентиляцию лёгких. Джексону ввели препарат дома. 

— Не думаете ли вы, что в современной медицине — перебор с обезболиваниями? 

— Мы стремимся, чтобы пациентам было комфортно, ведь любое оперативное вмешательство — это колоссальный стресс для организма. В XXI веке нам необходима адекватная анестезия, связанная с высокими  технологиями.

С головы до пяток                      

— Правда ли, что от действий анестезиолога на 50 % зависит благополучный исход операции? 

— Огромную роль играет этап подготовки к плановой операции. Анестезиолог подробно изучает анамнез пациента, объясняет, как будет действовать выбранный им вид наркоза. Каждый раз будто осматриваешь пациента с головы до пят. Спрашиваешь — как он себя чувствует, есть ли у него хронические заболевания, аллергии, данные лабораторной диагностики и многое другое. Допустим, некоторые виды анестезии противопоказаны при глаукоме. А тот же кариес может спровоцировать пневмонию. Узнаём мы и о вредных привычках пациента. 

Операция на сердце. Фото: www.globallookpress.com

— И если пациент зависит от никотина, алкоголя или наркотиков? 

— Курильщикам мы рекомендуем перед операцией выкурить треть сигареты. Потому что у них обычно начинается выработка большого количества мокроты, и это сильно осложняет работу врача. А человеку, страдающему хроническим алкоголизмом или наркоманией, обычно требуется больше анестетиков и сопутствующих препаратов. И не зря перед операцией чётко оговаривается время последнего приёма пищи и воды. Пациент, который идёт на плановое оперативное лечение, должен приходить с пустым желудком, иначе могут возникнуть осложнения, угрожающие его жизни. 

— Многие люди, прошедшие наркоз, рассказывают о красочных галлюцинациях во время операции…

— С анестетиками нового поколения пациенты в большинстве случаев уже не летают по космическим коридорам. Самый оптимальный вариант, когда человек после оперативного вмешательства  говорит: «Уже всё? Я так хорошо у вас выспался!»

Малыш, не болей! | Фотогалерея

Малыш, не болей! | Фотогалерея

Влияние дексмедетомидина в сочетании с люмбальной анестезией на Th2/Th3 у матерей и новорожденных, перенесших кесарево сечение

Введение

Кесарево сечение является важной акушерской операцией для разрешения выкидыша беременных женщин, которые не в состоянии родоразрешение из-за дистоции или некоторых акушерских осложнений (1). В развивающихся странах доля кесарева сечения у женщин-матерей демонстрирует ежегодный прирост, особенно в Китае (2).Текущая частота кесарева сечения в отделения акушерства и гинекологии большинства больниц Китая намного превышает допустимый предел, установленный Всемирной организацией здравоохранения. Организация (3,4). В 2004 г. 29,1% новорожденных были родоразрешение путем кесарева сечения в Соединенных Штатах, которое является самый высокий показатель из когда-либо зарегистрированных. Общий показатель увеличился на >40% с 1996 г., что отражает две одновременные тенденции: рост в начальной ставке (от 14,6 до 20,6%) и резкое снижение ставки вагинальных родов после кесарева сечения (28.от 3 до 9,2%) (5). В связи с увеличением числа кесаревых сечений и его востребованность, анестезия при кесаревом сечении крайне необходима важность. Анестезиологи должны выбрать подходящие обезболивающие препараты, методы и сроки сокращения времени операции и уменьшить степень хирургической травмы у матери (6,7). Распространенные методы кесарева сечения Раздельная анестезия в основном включает спинальную анестезию, эпидуральную анестезия, спинальная и эпидуральная комбинированная анестезия. Среди их, люмбальная анестезия является распространенным методом кесарева сечения анестезия (8,9).Люмбальная анестезия имеет преимущества: простота операции, быстрое начало анестезии, хорошее снятие раздражения, хорошее расслабление мышц и легкий контроль уровня анестезии. Однако ограничением является короткое время анестезии, которое не можно продлить (10–12).

Для достижения оптимальной анестезии при кесаревом сечении, выбор и комбинация анестезирующих препаратов имеют решающее значение факторы. Дексмедетомидин относится к α2-адренорецепторам. агонистов и является относительно селективным (13,14). фармакологические эффекты дексмедетомидина включают анксиолитический, седативные, обезболивающие, снотворные и симпатические блокады.Еда США и Администрация по лекарственным средствам одобрила использование дексмедетомидина в пациентов с искусственной вентиляцией легких в отделении интенсивной терапии для взрослых, а также в педиатрии, нейрохирургии и фибробронхоскопии для сердечно-сосудистой хирургии (15,16). применение дексмедетомидина может повлиять на иммунную систему пациентка матери и новорожденный (17). Предыдущее исследование показало, что дексмедетомидин оказывает противовоспалительные эффекты за счет регуляции Т-хелперов 2 типа клеточные (Th3)-ассоциированные цитокины интерлейкин (IL)-4 и IL-6 (18).Однако, будь то дексмедетомидин, вводимый при кесаревом сечении, влияет на иммунная система больных матерей и новорожденных остается во многом неуловимый. Поэтому настоящее исследование было направлено на изучение влияние дексмедетомидина в сочетании с люмбальной анестезией на Цитокины Th2/Th3 у матерей, перенесших кесарево сечение и их новорожденных.

Пациенты и методы
Общая информация для пациента

Всего госпитализировано 60 доношенных родильниц в отделение акушерства и гинекологии Ляочэн Народной больнице (Ляочэн, Китай), которым был поставлен диагноз: при одноплодной беременности и кесаревом сечении между Были выбраны январь 2017 года и сентябрь 2017 года.плод находился в положение головы и полная предоперационная подготовка. записать соответствующие клинические данные. Все пациентки были первородящими средний возраст 26,3±3,5 года (диапазон 22–37 лет), средний вес 74,7 ± 6,8 кг (диапазон 57–83) и средний рост 162,1±3,4 см (диапазон 152–175 см). Испытуемые получали рутинную предродовые обследования перед операцией, в том числе В-УЗИ и электрокардиограмма. Критерием включения было Американское общество анестезиологов (ASA) I или II степени (19).Критериями исключения были эклампсия у матери, III или IV класс по ASA, недоношенные дети, многоплодная беременность, противопоказания к спинномозговой анестезии, сахарный диабет, инфекции, осложнения беременности (например, синдром гипертензии, вызванной беременностью), болезни сердца, местные анестетики и аллергия на опиоиды, травма позвоночника в анамнезе, проблемы системы крови, включая дисфункцию свертывания крови, опиоиды применение в течение одной недели до операции и срока беременности >38 недель. Настоящее исследование было одобрено Этическим комитетом. Комитет народной больницы Ляочэн (Ляочэн, Китай).Все субъекты предоставили письменное информированное согласие.

Основные реактивы и инструменты

Реактив TRIzol, набор для выделения РНК, праймеры для ПЦР, Набор для обратной транскрипции кДНК высокой емкости (номер по каталогу 4368814) и Набор QuantiTect SYBR Green RT-PCR был приобретен у Invitrogen. (Термо Фишер Сайентифик, Инк.). ИЛ-2, ИЛ-4, ФНО-α и ИЛ-10 ИФА наборы были приобретены у eBioscience. Микропланшет Labsystem 1.3.1 Ридер был получен от Bio-Rad Laboratories.

Группировка

Испытуемые были поровну и случайным образом разделены на контрольная группа, получавшая люмбальную эпидуральную анестезию, и комбинированная группа, получавшая дексмедетомидин в сочетании с поясничным эпидуральная анестезия.Дексмедетомидин постоянно вводили в пространство L3-L4 для поясничной эпидуральной анестезии с использованием микронасоса на доза 0,8 мг/кг.

Оценка по визуальной аналоговой шкале (ВАШ), побочные реакции, тракционная реакция и оценка новорожденных по шкале Апгар

Тракционная реакция оценивалась с помощью стандарт для оценки эффекта реакции на тягу, а именно: 1, нет дискомфорта в промежности или желудке, нет рвоты, тошноты или метеоризм; 2, легкий дискомфорт в области половых органов или желудка, отсутствие тошноты или рвота; 3, боль в промежности, дискомфорт в желудке, очевидный метеоризм, или даже тошнота и рвота, которые требуют лечения лекарствами. Оценка по ВАШ (0 — отсутствие боли; 10 — самая сильная боль, какую только можно представить) была оценивали через 1 ч после операции и использовали для оценки боли. После неонатальных исходов оценка по шкале Апгар проводилась педиатрами в 1-я и 5-я минуты. Побочные реакции, включая тошноту, регистрировались зуд, рвота и угнетение дыхания. интраоперационно и через 1, 2, 6 и 12 ч после операции.

Сбор проб крови и хранилище

пробы крови были взяты из каждой группы на послеоперационный день 1.Всего было взято 2 мл крови. воротная вена новорожденных. Образец центрифугировали при 2000× г в течение 15 мин при 4°С. Сыворотку помещают в пробирку Эппендорфа и хранить при -20°С.

Количественная обратная транскрипция (RT-q) ПЦР

Суммарная РНК была выделена из периферической крови. мононуклеарные клетки с использованием TRIzol и обратной транскрипцией в комплементарная ДНК. Праймеры были разработаны Primer Premier 6.0. (Таблица I) и синтезированы Сангоном. Биотех. Условия термоциклирования ПЦР были следующими: 52°C для 1 мин и 35 циклов 92°C в течение 30 секунд, 58°C в течение 50 секунд и 72°C в течение 35 сек.Метод 2−∆∆Cq (20) был применен для расчета уровень экспрессии.

Таблица I.

Последовательности праймеров, используемых для ПЦР.

Таблица I.

Последовательности праймеров, используемых для ПЦР.

Ген Прямой (5′-3′) Обратный (5′-3′)
GADPH AGTGCCAGCCTCGTCTCATAG CGTTGAACTTGCCGTGGGTAG
Ил-2 CAGAGATCTAAGCAGCGACTT TGGGACCTCATCTCCGTCA
TNF-α GATCTCCTAAACGGAATAGCG GACTCTGGCTCAATCCGTC
Ил-4 AACGGGCCTAAGGATTCCAAT TGGCTGCACATCGTCA
Ил-10 TCTCAAGAGCGTCAAGATA AATCTCTCCGTCAATCCT
ИФА

Сывороточные уровни ИЛ-2, ИЛ-4, ИЛ-10 и ФНО-α в каждую группу выявляли с помощью ELISA.Собранная периферическая кровь центрифугировали и получали супернатант. Экспериментальный Процедуру проводили в соответствии с инструкциями набора ELISA. Разбавленное стандартное вещество и образцы объемом 50 мкл добавляли в 96-луночный планшет и инкубировали при 37°С в течение 30 мин. После стирки 5 раз в каждую лунку добавляли 50 мкл реагента А и 50 мкл реагента В, с последующей инкубацией при 37°С в течение 10 мин. Наконец, стоп 50 мкл. раствор добавляли в каждую лунку и измеряли абсорбцию на считыватель микропланшетов.Была построена стандартная кривая для определения концентрация образца на основе значения оптической плотности.

Статистический анализ

Все анализы данных были выполнены с использованием SPSS 22.0 программное обеспечение (корпорация IBM). Данные измерений выражали как среднее значение ± стандартное отклонение и сравнивали с использованием непарного критерия Стьюдента. т-тест. Корреляции оценивали по корреляции Пирсона анализ. Тестовый уровень был установлен на уровне α=0,05. Р<0,05 был расценивается как указание на статистически значимое различие.

Результаты
Дексмедетомидин снижает ВАШ оценка материнских женщин после кесарева сечения под поясничным анестезия

Боль в каждой группе оценивали по ВАШ скоринговый метод. Результаты показали, что через 1 ч после операции оценка по ВАШ в группе комбинированной терапии была значительно ниже, чем что в контрольной группе с люмбальной анестезией (P<0,05; рис. 1).

Дексмедетомидин уменьшает нежелательные реакции у женщин при кесаревом сечении под поясничным анестезия

Побочные реакции в контрольной группе, получавшей люмбальная анестезия и в группе комбинированного приема дексмедетомидина в сочетании с люмбальной анестезией.Это было указано, что дексмедетомидин в дополнение к люмбальной анестезии явно уменьшились побочные реакции, такие как тошнота, рвота, озноб и кожный зуд во время операции кесарева сечения по сравнению с контрольной группой с люмбальной анестезией (Р<0,05; Таблица 2).

Таблица II.

Влияние дексмедетомидина в сочетании с люмбальной анестезией на побочные реакции у женщин, получающих кесарево сечение.

Таблица II.

Влияние дексмедетомидина в сочетании с люмбальной анестезией на побочные реакции у женщин, получающих кесарево сечение.

A
GROUP BRADYCARDIA METCHING Гипотензия Тошнота / рвота Всего
Control (N = 30) 2 (6.6) 5 (16.6) 4 (13,3) 6 (20,0) 17 (56,6)
Комбинация (n=30) 1 (3.3) 1 (3.3) 2 (6.6) A 1 (3.3) A 5 (16.6) A
Дексмедетомидин снижает тягу реакция женщин с кесаревым сечением под поясничным анестезия

Тракционная реакция женщин с кесаревым сечением раздел сравнивали между двумя группами. Результаты продемонстрировали, что дексмедетомидин в сочетании с люмбальной анестезией снижена тракционная реакция по сравнению с таковой в поясничном отделе контрольная группа анестезии (P<0.05; Таблица III).

Таблица III.

Влияние дексмедетомидина комбинированное при люмбальной анестезии на тракционную реакцию у женщин с кесарево сечение.

Таблица III.

Влияние дексмедетомидина комбинированное при люмбальной анестезии на тракционную реакцию у женщин с кесарево сечение.

Реакция тяги оценка

Группа 1 2 3
Control (N = 30) 15 (50) 11 (16.7) 4 (13,3)
Комбинация (n=30) 27 (90) а 2 (6.7) а 1 (3.3) и
Эффект применения дексмедетомидина при кесаревом сечении в сочетании с люмбальной анестезией на Оценка по шкале Апгар у новорожденных

Отсутствие статистически значимой разницы по шкале Апгар оценка новорожденных была определена между двумя группами (P>0,05; Рис. 2).

Влияние дексмедетомидина комбинированное при люмбальной анестезии при кесаревом сечении на цитокины Th2 в самки по материнской линии

Нет существенных различий в уровнях TNF-α (96.3±6,5 пг/мл в контроле и 95,9±5,3 пг/мл в контроле. комбинированная группа) и ИЛ-2 (81,6±4,7 пг/мл в контроле и 83,5±4,3 пг/мл в комбинированной группе) наблюдались между Две группы перед операцией. RT-qPCR и ELISA были приняты для проверки влияние дексмедетомидина в сочетании с люмбальной анестезией на Уровни мРНК и белка TNF-α и IL-2 в крови матери женщины. Результаты показали, что дексмедетомидин в сочетании с люмбальная анестезия у женщин с кесаревым сечением заметно снижал экспрессию и секрецию TNF-α и IL-2 по сравнению с таковые в контрольной группе (P<0.05; Рис. 3 и 4).

Влияние дексмедетомидина комбинированное при люмбальной анестезии на цитокины Th3 у женщин-матерей

Нет существенных различий в уровнях ИЛ-4 (60,3±3,2 пг/мл в контроле и 64,1±3,9 пг/мл в контроле). комбинированная группа) и ИЛ-10 (139,2±6,1 пг/мл в контроле и 145,3±8,1 пг/мл в комбинированной группе) наблюдались между Две группы перед операцией. RT-qPCR и ELISA были адаптированы для определить влияние дексмедетомидина в сочетании с поясничным анестезии на уровни ИЛ-4 и ИЛ-10 в крови матери.Результаты показали, что дексмедетомидин в сочетании с люмбальной анестезией в женщины с кесаревым сечением стимулировали мРНК IL-4 и IL-10 экспрессия и секреция белка по сравнению с таковыми в контроле группе (P<0,05; рис. 5 и 6).

Комбинированное действие дексмедетомидина при люмбальной анестезии на цитокины Th2 у новорожденных

RT-qPCR и ELISA были приняты для проверки влияния дексмедетомидин в сочетании с люмбальной анестезией на TNF-α и IL-2 Уровни мРНК и белка в крови новорожденных.Результаты указали, что дексмедетомидин в сочетании с люмбальной анестезией вызвал значительное снижение экспрессии мРНК TNF-α и IL-2. секрецию белка у новорожденных по сравнению с контрольная группа (P<0,05; рис. 7 и 8).

Влияние дексмедетомидина комбинированное при люмбальной анестезии на цитокины Th3 у новорожденных

RT-qPCR и ELISA были приняты для определения Влияние дексмедетомидина в сочетании с люмбальной анестезией на ИЛ-4 уровни мРНК и белка IL-10 в крови новорожденных. результаты показали, что дексмедетомидин в сочетании с поясничным анестезия способствовала экспрессии мРНК IL-4 и IL-10 и секреция у новорожденных по сравнению с контрольной группой (P<0,05; рис. 9 и 10).

Обсуждение

Дексмедетомидин используется в клинике для обезболивания, седативный эффект и уменьшение количества анестетиков. Разумное применение анестетиков может снизить частоту послеоперационных осложнений и быстро оказывать анестезирующее действие для достижения своевременное восстановление и способствовать улучшению и восстановлению позвоночника повреждение спинного мозга (21).Несмотря на то что дексмедетомидин не рекомендуется беременным женщинам, ранее исследование показало, что соответствующие дозы дексмедетомидина полезен для седации беременных (22). Кроме того, дексмедетомидин регулирует подавление иммунитета, вызванное стресс, связанный с операцией (23). В В настоящем исследовании эффекты дексмедетомидина в сочетании с люмбальную анестезию сравнивали с таковой при люмбальной анестезии. только у матерей, перенесших кесарево сечение, и их новорожденных.Результаты показали, что дексмедетомидин в сочетании с люмбальная анестезия уменьшила баллы по ВАШ, побочные реакции и тракционные реакции без влияния на оценку новорожденных по шкале Апгар. Эти результаты позволяют предположить, что дексмедетомидин в сочетании с поясничным анестезия усиливает обезболивающий эффект и способствует восстановлению пациентки матери после кесарева сечения.

Послеоперационные осложнения, связанные с анестезией являются одной из проблем, влияющих на хирургический процесс и послеоперационное восстановление больных кесаревым сечением, в основном включая зуд, послеоперационную боль, угнетение дыхания, озноб и гипотензия (24,25).Однако в настоящем исследовании использование показано применение дексмедетомидина в сочетании с люмбальной анестезией. уменьшить побочные реакции и тракционную реакцию. Увеличение секреция факторов воспаления Th2 IL-2 и TNF-α активирует воспалительную реакцию и способствует адгезии лейкоцитов, создание условий для дальнейшего развития воспаления (26,27). Цитокины Th3 IL-4 и IL-10 противодействуют воспалительным цитокинам Th2 и подавляют Th2 реакция и последующее высвобождение связанных факторов для усиления гуморальный иммунный ответ (28).Wegmann et al (29) первый постулировал концепцию о том, что переход от реакции Th2 к реакции Th3 предвзятость возникает во время беременности, что функционально индуцирует материнскую Иммунная толерантность и подавление. В нескольких клинических исследованиях продемонстрировали смещение Th3 в профиле циркулирующих Th-цитокинов у нормальная беременность, и увеличение отношения Th2 в случаях привычный выкидыш (30) и в преэклампсия (31). Настоящее исследование показало, что дексмедетомидин в сочетании с поясничным анестезия привела к снижению экспрессии IL-2 и TNF-α, и повышенная экспрессия ИЛ-4 и ИЛ-10 у самок после кесарево сечение и их новорожденных по сравнению с теми, кто получил только люмбальную анестезию.Хотя кесарево сечение может влияют на уровень ИЛ-2 и ИЛ-4, существенных различий нет по сравнению с беременными женщинами с нормальными родами были сообщили (32). В настоящее время исследование, все участники получили кесарево сечение; Следовательно изменения ИЛ-2 и ИЛ-4 обусловлены разным анестетиком лечения. Изменения цитокинов Th2/Th3, наблюдаемые в Настоящее исследование показывает, что дексмедетомидин в сочетании с поясничным анестезия модулирует баланс Th2/Th3 и ингибирует клетки Th2 дифференциация, согласующаяся с предыдущим исследованием, демонстрирующим что дексмедетомидин ингибирует воспаление за счет повышения регуляции Th3-ассоциированные цитокины IL-4 и IL-6 (18).Однако точные механизмы того, как дексмедетомидин модулирует баланс Th2/Th3 у самок получающих кесарево сечение, и их новорожденные нуждаются в дальнейшем разъяснение.

В заключение, дексмедетомидин в дополнение к поясничному эпидуральная анестезия снижает оценку матери по ВАШ, неблагоприятные реакции и тяговой реакции, а также способствует конверсии цитокинов Th2 на цитокины Th3 у самок-матерей, получающих кесарево сечение и их новорожденных.

Благодарности

Не применимо.

Финансирование

Финансирование не получено.

Наличие данных и материалов

Не применимо.

Вклад авторов

WS и PZ провели эксперименты и проанализировали данные. WS разработал исследование и написал рукопись.

Этическое одобрение и согласие на участвовать

Настоящее исследование было одобрено Этическим комитетом. Комитет народной больницы Ляочэн (Ляочэн, Китай). Все субъекты предоставили письменное информированное согласие.

Согласие пациента на публикацию

Не применимо.

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересы.

Ссылки

1

Поли-Нето О.Б., Кампос Мартинс Чамочумби С, Тоскано П., Питанги Хулио М., Маркес В. младший, Роса-Э-Сильва Дж. К., Кандидо-Дос-Рейс Ф.Дж. и Ногейра А.А.: Электромиография характеристика триггерных точек брюшной стенки, развившихся после кесарево сечение и реакция на местную анестезию: наблюдательное исследование.БЖОГ. 125:1313–1318. 2018. Просмотр статьи: Google Scholar: PubMed/NCBI

2

Feng XL, Xu L, Guo Y и Ronsmans C: Факторы, влияющие на рост частоты кесарева сечения в Китае между 1988 и 2008 гг. Bull World Health Organ. 90:30–39, 39А. 2012. Просмотр статьи : Академия Google : PubMed/NCBI

3

Сингал С., Бхарти Р., Деван Р., Дивья, Дабрал А, Батра А, Шарма М и Миттал П: клинические результаты постплацентарное введение меди Т 380А женщинам, рожавшим кесарево сечение.J Clin Diagn Res. 8: ОС01–ОС04. 2014. PubMed/NCBI

.

4

Озкан Сейхан Т., Орхан-Сунгур М., Басаран Б., Савран Карадениз М., Демиркан Ф., Сюй З. и Сесслер Д.И.: Эффект внутрибрюшное давление на уровне сенсорного блока однократного Спинальная анестезия при кесаревом сечении: обсервационное исследование. Интерн. Дж. Обстет Анест. 24:35–40. 2015. Просмотр статьи: Google Scholar: PubMed/NCBI

.

5

Менакер Ф., Деклерк Э. и Макдорман М.Ф.: Кесарево сечение: Предыстория, тенденции и эпидемиология.Семин перинатол. 30:235–241. 2006. Просмотр статьи: Google Scholar: PubMed/NCBI

.

6

Эль-Агвани А.С.: Важные наблюдения в хирургическая техника кесарева сечения и предполагаемые этапы. Арка Гинекол Обст. 297: 1075–1077. 2018. Просмотр статьи: Google Scholar: PubMed/NCBI

7

Лю Ц, Сунь В, Ван Ц, Лю Ф и Чжоу М: Доставка во время экстракорпоральной мембранной оксигенации (ЭКМО) беременной женщины с тяжелым респираторным дистресс-синдромом, вызванным гриппом: отчет о болезни и обзор литературы.Джей Матерн Фетальная неонатальная мед. 32:2570–2574. 2019. Просмотр статьи: Google Scholar: PubMed/NCBI

8

Ши YC, Guo H, Chen J, Sun G, Ren RR, Guo MZ, Peng LH и Yang YS: первоначальный микробиом мекония на китайском языке новорожденных, родившихся естественным путем или путем кесарева сечения. Научный представитель 8:32552018. Просмотр статьи : Академия Google : PubMed/NCBI

9

Карнесс Дж. М. и Ленарт М. Дж.: Спинной анестезия при кесаревом сечении у пациентки по сосудистому типу синдром Элерса-Данлоса.Представитель по делу Anesthesiol. 2018:19247252018.PubMed/NCBI

10

Ямасита А и Ирикома С: сравнение инфляционный неинвазивный мониторинг артериального давления (iNIBP) технология и обычная дефляционная неинвазивная кровь измерение давления (dNIBP) для выявления гипотонии во время кесарево сечение. JA Clin Rep. 4:52018. Просмотр статьи : Академия Google : PubMed/NCBI

11

Нишио Ю, Хираки Т, Танигути Х и Усидзима К.: Анестезиологическое обеспечение во время кесарева сечения в пациент с ключично-черепной дисплазией: история болезни.Представитель JA Clin 4:22018. Просмотр статьи : Академия Google : PubMed/NCBI

12

Бард М., Берсо Ю., Легрос В., Раймонд Э. и Малиновский Ю.М.: Мониторинг гемодинамики по скорости аорты во времени интегральная в супрастернальной допплерэхокардиографии и тотальная кавопульмональное отведение при кесаревом сечении. Джей Клин Анест. 46:99–100. 2018. Просмотр статьи: Google Scholar: PubMed/NCBI

13

Эскандр А.М., Метвалли А.А., Ахмед А.А., Эльфеки Э.М., Элдесоки И.М., Обада М.А. и Абд-Эльмегид О.А.: Дексмедетомидин как часть общей анестезии при кесаревом сечении у пациенток с преэклампсия: рандомизированное двойное слепое исследование.евро J Анестезиол. 35:372–378. 2018. PubMed/NCBI

14

Fan L, Zhang J, Lv Z, Guo H и Zhao Y: Клинические исследования дексмедетомидина, применяемого для контролируемая пациентом седация во время операции на нижних конечностях под комбинированная спинально-эпидуральная анестезия. Пак Дж Фарм Наук. 29:1095–2100. 2016. PubMed/NCBI

.

15

Сайед Э. и Яссен К.А.: Интраоперационная Влияние инфузии дексмедетомидина на печень живого донора трансплантация: рандомизированное контрольное исследование.Сауди Джей Анаст. 10: 288–294. 2016. Просмотр статьи: Google Scholar: PubMed/NCBI

.

16

Дас А., Чхауле С., Бхаттачарья С., Басуния SR, Mitra T, Halder PS, Chattopadhyay S и Mandal SK: под контролем артериальная гипотензия в условиях дневного стационара при функциональной эндоскопической хирургии околоносовых пазух: A сравнение между эсмололом и дексмедетомидином: проспективное, двойное слепое и рандомизированное исследование. Сауди Джей Анаст. 10: 276–282. 2016. Просмотр статьи: Google Scholar: PubMed/NCBI

.

17

Конти Г., Раньери В.М., Коста Р., Гарратт С., Уайтон А., Спинаццола Г., Урбино Р., Маскиа Л., Ферроне Г., Похьянжуси P и др.: Влияние дексмедетомидина и пропофола на взаимодействие пациента с аппаратом искусственной вентиляции лёгких в трудно отнимаемом, механически вентилируемые пациенты: проспективное, открытое, рандомизированное, многоцентровое исследование.Критический уход. 20:2062016. Просмотр статьи : Академия Google : PubMed/NCBI

18

Ли Б, Ли Ю, Тянь С, Ван Х, У Х, Чжан А и Gao C: Противовоспалительные эффекты периоперационного дексмедетомидин в качестве дополнения к общей анестезии: A Метаанализ. Научный отчет 5:123422015. Просмотр статьи : Академия Google : PubMed/NCBI

19

Дойл Д.Дж. и Гармон Э.Х.: Американское общество Классификация анестезиологов (класс ASA).StatPearls [Интернет] Остров сокровищ (Флорида): StatPearls Publishing; 2019 янв 19

20

Ливак К.Дж. и Шмитген Т.Д.: Анализ данные об относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метод 2(-Delta Delta C(T)). Методы. 25:402–408. 2001. Просмотр статьи : Академия Google : PubMed/NCBI

21

Юань Ф, Фу Х, Ян П, Сунь К, Ву С, Lv М, Dong Z и Dong T: Дексмедетомидин-фентанил в сравнении с пропофол-фентанил при гибкой бронхоскопии: рандомизированное исследование.опыт Тер Мед. 12: 506–512. 2016. Просмотр статьи: Google Scholar: PubMed/NCBI

.

22

Наир А.С. и Шрипракаш К.: Дексмедетомидин во время беременности: Обзор литературы и возможное использование. J Акушерство Интенсивная анестезия. 3:3–6. 2013. Просмотр статьи : Google Scholar

23

Ван Л, Чжан А, Лю В, Лю Х, Су Ф и Ци L: Влияние дексмедетомидина на периоперационную стрессовую реакцию, воспаление и иммунная функция у пациентов с различной степенью цирроза печени.Эксперт Тер Мед. 16:3869–3874. 2018. PubMed/NCBI

24

Боудан К.Д., Магар Дж.С. и Тендолкар Б.А.: Двойное слепое сравнение комбинации 0,1% ропивакаина и фентанил к комбинации 0,1% бупивакаина и фентанила для экстрадуральная анальгезия в родах. J Anaesthesiol Clin Pharmacol. 32:38–43. 2016. Просмотр статьи: Google Scholar: PubMed/NCBI

.

25

Кундра Т.С., Нагараджа П.С., Сингх Н.Г., Дхананджая М., Сатиш Н. и Манджунатха Н.: Эффект дексмедетомидина на диаметр пораженных коронарных сосудов и защиту миокарда в пациентов с чрескожным коронарным вмешательством.Энн Кард Анаст. 19: 394–398. 2016. Просмотр статьи: Google Scholar: PubMed/NCBI

.

26

Чон Си, Шин Джа, Чо С, Ким ХВ, Ли Джи, Канг Дж. Л. и Пак Э. М.: Ресвератрол ослабляет периферическую и мозговую воспаление и уменьшает ишемическое повреждение головного мозга у старых самок мышей. Нейробиол Старение. 44:74–84. 2016. Просмотр статьи: Google Scholar: PubMed/NCBI

.

27

Эльмутаз Махмуд Х и Рашван ДЭ: Эффективность дексмедетомидина по сравнению с кетофолом для седации послеоперационные пациенты на ИВЛ с обструктивными апноэ сна.Crit Care Res Pract. 2018:10150542018.PubMed/NCBI

28

Lee CH, Park JH, Ahn JH и Won MH: Влияние мелатонина на когнитивные нарушения и гиппокамп повреждение нейронов в крысиной модели хронической церебральной гипоперфузии. Эксперт Тер Мед. 11:2240–2246. 2016. Просмотр статьи: Google Scholar: PubMed/NCBI

.

29

Вегманн Т.Г., Лин Х., Гилберт Л. и Мосманн TR: Двунаправленные взаимодействия цитокинов в организме матери и плода. отношения: Является ли успешная беременность феноменом Th3? Иммунол Сегодня.14: 353–356. 1993. Просмотр статьи: Google Scholar: PubMed/NCBI

.

30

Дракманн Р. и Дракманн М.А.: Прогестерон и иммунология беременности. J Steroid Biochem Mol Biol. 97: 389–396. 2005. Просмотр статьи: Google Scholar: PubMed/NCBI

.

31

Лин Х., Мосманн Т.Р., Гилберт Л., Tuntipopipat S и Wegmann TG: Синтез T-хелпера 2-типа цитокины на границе матери и плода.Дж Иммунол. 151:4562–4573. 1993. PubMed/NCBI

.

32

Werlang ICR, Mueller NT, Pizoni A, Wisintainer H, Matte U, Costa SHAM, Ramos JGL, Goldani MZ, Домингес-Белло М.Г. и Гольдани Х.А.С.: Ассоциации способа рождения с цитокины пуповинной крови, лейкоциты и кишечник новорожденных бифидобактерии. ПЛОС Один. 13:e02059622018. Просмотр статьи : Академия Google : PubMed/NCBI

Полная статья: Гипотензия во время спинномозговой анестезии при кесаревом сечении в условиях ограниченных ресурсов: к консенсусному определению

Введение

Кесарево сечение (КС) является одной из наиболее ставка 23%. 1 Хотя спинномозговая анестезия (СА) является текущим стандартом лечения КС в Южной Африке, она обычно связана с интраоперационной гипотензией, приводящей к тошноте и рвоте, 2 компрометации плода, 3 потере сознания матери и остановке сердца. Определения интраоперационной гипотензии сильно различаются. Klohr и коллеги рассмотрели 15 опубликованных определений акушерской спинальной гипотензии, которые включали как абсолютные, так и относительные пороги, а также их комбинации. 4 Применение этих определений привело к возникновению гипотензии в диапазоне от 7,4% до 74,1%.

Проблема отсутствия единого стандартного определения. Во-первых, разные определения затрудняют оценку частоты гипотензии в конкретной популяции и оценку качества ухода за пациентами, связанного с анестезией. Во-вторых, без последовательного определения гипотензии становится трудно разработать сопоставимые клинические интервенционные исследования. В-третьих, противоречивые определения препятствуют обобщению результатов клинических исследований. 5 Недавнее международное согласованное руководство подчеркивает упомянутые выше опасения. 6 Хотя в этом руководстве не предлагается согласованное определение, в нем предлагается ориентироваться на систолическое артериальное давление (САД) > 90% от точно измеренного исходного уровня; и вмешательство с вазопрессором, когда САД < 80% от исходного уровня. Определения и трактовка также должны быть чувствительны к контексту, в котором они встречаются. 7 Это исследование было направлено на определение частоты возникновения гипотонии при акушерской спинномозговой анестезии при использовании текущих национальных рекомендаций по интраоперационному контролю артериального давления в условиях ограниченных ресурсов, а также на использование этих случаев совместно с соответствующей литературой, чтобы предложить определение для использования в Южноафриканский контекст.

Методы

Сначала мы определили определения гипотензии, взятые из недавнего систематического обзора литературы, проведенного Klohr. 4 Кроме того, мы обеспечили включение последних релевантных определений, например, из недавнего консенсусного заявления. 6 Затем мы применили эти определения к данным, полученным в ходе проспективного исследования, проведенного в больнице Эдендейл. В этом исследовании сравнивали профилактические инфузии фенилэфрина с текущим стандартным протоколом лечения, используемым для уменьшения выраженной акушерской спинальной гипотензии во время кесарева сечения в Южной Африке. 8 Мы провели анализ гемодинамических данных 253 пациентов из контрольной группы. Разрешение на проведение исследования было предоставлено Комитетом по биомедицинской этике Университета Квазулу-Наталь (BE007/18), больницей Эдендейл и Департаментом здравоохранения Квазулу-Натала (KZ_201802_042).

Пациенты и условия

Исходное исследование проводилось в больнице Эдендейл, региональной больнице в Питермарицбурге, провинция Квазулу-Натал, Южная Африка. 8 Исследуемая популяция состояла из 506 рожениц, которым было выполнено плановое или экстренное КС в обычное рабочее время (07:40–16:00).Контрольную группу составили 253 пациента, лечение которых проводилось в соответствии с действующими национальными рекомендациями. Данные этой группы использовали для анализа гемодинамических показателей. Лечение вазопрессорами было начато в контрольной группе, если САД < 90 мм рт.ст., с использованием либо фенилэфрина, либо эфедрина. Критерии исключения были определены исходным исследованием и включали возраст  < 18 лет и тех, кто был переведен в GA для неудачного SA в течение периода исследования.

Проведение анестезии

Приведенная ниже информация относится к проведению анестезии в исходном исследовании.На протяжении всего исследования соблюдались обычные стандарты акушерской анестезии в больнице Эдендейл. Стажеры и анестезиологи-стажеры проводили анестезию как обычно, но находились под наблюдением анестезиолога, имеющего как минимум диплом анестезиолога или его эквивалент. Соответствующие данные о результатах были зарегистрированы в течение периода исследования, которое началось с показателей жизненно важных функций непосредственно перед введением СА и закончилось через 15  минут после рождения новорожденного. Перед введением СА у пациентов регистрировали исходную частоту сердечных сокращений и неинвазивное артериальное давление (НИАД).NIBP циклически повторяли с интервалом в одну минуту до завершения периода исследования. Гипотонию лечили вазопрессором, если САД был ниже 90 мм рт.ст. следующим образом: фенилэфрин вводили в дозе 50-100 мкг в виде внутривенного болюса (ЧСС ≥ 70 уд/мин) или эфедрин 5-10 мг (ЧСС < 70). ударов в минуту).

Статистический анализ

Исходные характеристики включенных пациентов регистрировали как среднее (стандартное отклонение [SD]) для непрерывных переменных с нормальным распределением; медиана и диапазон для данных, не распределенных нормально; и количество (в процентах) для категориальных переменных.Описательная статистика использовалась для описания случаев гипотонии с использованием различных определений. К ним относятся абсолютные определения (САД < 80, 90, 100 мм рт.ст.; среднее артериальное давление [САД] < 60, 65, 70 мм рт.ст.) и относительные определения (снижение САД на 10%, 20% и 30% ниже исходного уровня; снижение среднего артериального давления ниже 10%). , 20% и 30% от исходного уровня). Также использовались комбинированные определения (САД < 80 мм рт.ст. или среднее АД снижается на 30%; САД < 90 мм рт.ст. или среднее АД снижается на 20%). Эти определения применялись к периоду между введением спинальной анестезии и родами.Далее мы провели ограниченный анализ, основанный на разных временных периодах: от рождения новорожденного до 15 минут после родов и от введения позвоночника до 15 минут после родов. Данные были представлены в виде доли исследуемой популяции вместе с 95% доверительными интервалами.

Результаты

Окончательный анализ включал 253 пациента. Средний возраст пациентов составил 27 лет (от 18 до 47 лет), а средний индекс массы тела — 32 года (от 22 до 58 лет). Медиана тяжести была 2 (диапазон 1-9), паритет был 1 (диапазон 0-7) и средний срок беременности был 38 (диапазон 24-44).Частота ВИЧ-положительных пациентов составила 48% (95% доверительный интервал [ДИ] 42,1–54,4%). Диабетики составили 2% (95% ДИ 0,8–4,7%), гипертензивные нарушения беременности 11% (95% ДИ 7,7–15,6) и эклампсии 2% (95% ДИ 0,8–4,7%).

Частота гипотензии по абсолютным определениям, САД и САД графически представлена ​​на рисунках 1 и 2 соответственно. Они иллюстрируют случаи гипотензии, выходящие за рамки обычно используемых в литературе определений. Рассматриваемый период для этого исследования был от времени вставки позвоночника до рождения ребенка.При пороговых значениях САД 80, 90 и 100  мм рт. ст. случаи гипотензии составляли 16%, 33% и 49% соответственно — они показаны на рисунке 1. консенсусное определение https://doi.org/10.1080/22201181.2018.1550872

Опубликовано в Интернете:
11 декабря 2018 г.

Рисунок 1: Частота гипотензии по абсолютному определению САД.Примечание: САД =систолическое артериальное давление.

Гипотензия во время спинномозговой анестезии при кесаревом сечении в условиях ограниченных ресурсов: к консенсусному определению абсолютное определение MAP. Примечание: MAP = среднее артериальное давление.

Рисунок 2: Частота гипотензии по абсолютному определению MAP. Примечание: MAP = среднее артериальное давление.

Используя абсолютные значения, частота гипотензии составила 34%, 49% и 61% при пороговых значениях среднего артериального давления 60, 65 и 70 мм рт.ст. соответственно (см. рис. 2).

В таблице 1 представлены случаи гипотензии с использованием абсолютных определений, в таблице 2 — случаи с использованием относительных определений, а в таблице 3 — комбинированные определения.

Гипотензия во время спинномозговой анестезии при кесаревом сечении в условиях ограниченных ресурсов: к консенсусному определению с использованием значений абсолютного артериального давления

Гипотензия во время спинномозговой анестезии при кесаревом сечении в условиях ограниченных ресурсов: к согласованному определению https://doi.org/10.1080/22201181.2018.1550872

Опубликовано онлайн:
11 декабря 2018 г.

Согласованное определение https://doi.org/10.1080/22201181.2018.1550872

Опубликовано в Интернете:
11 декабря 2018 г.

во время которого была диагностирована гипотензия.Мы использовали три определения гипотензии, основанные на трех наиболее распространенных определениях, используемых в исследовании Klohr. 4 Эти результаты отражены в таблице 4.

Гипотензия во время спинномозговой анестезии при кесаревом сечении в условиях ограниченных ресурсов: на пути к консенсусному определениюhttps://doi.org/10.1080/22201181.2018.1550872

2018

Таблица 4. Частота гипотензии по периодам времени

Обсуждение

За последние несколько десятилетий отделения интенсивной терапии (ОИТ) отчасти перешли к использованию абсолютных порогов среднего артериального давления в качестве предпочтительных терапевтических целевых показателей артериального давления из-за улучшенного согласования между инвазивными и неинвазивными методами измерения артериального давления при использовании MAP в отличие от SBP. 9 Неинвазивные методы, по-видимому, завышают САД при низком артериальном давлении, что является клинически значимым признаком, ведущим к недодиагностике гипоперфузии. 10 Неинвазивные методы осциллотонометрии измеряют прямое САД, но определяют САД и ДАД с помощью алгоритмов, специфичных для бренда, возможно, с учетом различий в этом измерении. 10 Целевые показатели САД последовательно предсказывают частоту повреждения почек в отделении интенсивной терапии (ниже целевого значения 60 мм рт. ст.) при инвазивном и неинвазивном измерении, в то время как целевые значения САД требуют различных пороговых значений для предсказания повреждения почек в зависимости от метода измерения. 9 Руководства по целевым значениям СрАД у пациентов с сепсисом в критическом состоянии в настоящее время предлагают целевые значения СрАД  ≥ 65 мм рт.ст. 11

Неакушерские интраоперационные пороги гипотензии также страдают от большого разнообразия определений: в одном систематическом обзоре было найдено 140 определений из 130 статей. 12 Определения, использующие MAP в качестве цели, в последнее время стали пользоваться популярностью. Большое исследование показало, что относительные пороги не давали никаких преимуществ перед абсолютными порогами в отношении ассоциации с повреждением миокарда или почек при некардиальной хирургии, 13 , и что вероятность повреждения миокарда и почек ниже порога среднего артериального давления 65  мм рт.Дополнительные данные свидетельствуют о том, что даже короткие периоды ниже среднего АД 55  мм рт. ст. в значительной степени связаны с повреждением миокарда и почек. 14

Имеются минимальные данные для информирования о клинически значимых пороговых значениях артериального давления при акушерской анестезии. Первоначальные исследования на животных показали, что маточно-плацентарная ауторегуляция поддерживается довольно постоянно выше среднего артериального давления 60  мм рт.ст. в отсутствие анестезии. 15 Более низкое САД у матери (но не САД) во время беременности, по-видимому, связано с увеличением частоты мертворождений, 16 , хотя это может не распространяться на интраоперационные цели.Основные международные исследования акушерской анестезии отдали предпочтение САД < 20% исходного уровня, 17,18 САД < 90 мм рт.ст. 19 и комбинированному определению (САД < 20% исходного уровня или САД < 90 мм рт.ст.). 20 Опрос специалистов-акушеров-анестезиологов, проведенный в Великобритании, показал, что большинство из них предпочитают абсолютные пороги САД либо  < 90 мм рт.ст., либо <100 мм рт.ст. 21 Недавнее международное консенсусное заявление о вазопрессорной терапии спинальной гипотензии комментирует несколько используемых определений. 6 Авторы заявляют, что, хотя MAP является лучшим показателем перфузии органов, маловероятно, что он будет использоваться из-за отсутствия подтверждающих данных. Они советуют стремиться к сохранению САД ≥ 90% от исходного уровня до рождения новорожденного и стремиться к уменьшению количества эпизодов САД < 80% от исходного уровня. Лечение ниже этого уровня следует проводить быстро, обычно с помощью вазопрессоров. Это утверждение обязательно основано на некоторой догадке: акушерские исследования отстают от внесердечной хирургии, где было проведено множество исследований для определения уровня, на котором происходит повреждение органов.Однако есть убедительные доказательства того, что жесткий контроль артериального давления у бодрствующего пациента эффективен для уменьшения тошноты и рвоты. 22 Такие исходы, как повреждение миокарда или почек при акушерской спинномозговой анестезии, встречаются редко, за исключением коллапса матери или продолжительной тяжелой гипотензии. Важность жесткого контроля артериального давления в подавляющем большинстве случаев заключается в предотвращении симптомов. Допущение небольшого превышения артериального давления, а не гипотензии, может быть выгодным, особенно в условиях ограниченных ресурсов, потому что раннее вмешательство не только предотвратит симптомы, но и потенциально позволит избежать резкой гипотензии.

Подобно исследованию Klohr, мы обнаружили резкое изменение частоты интраоперационной гипотензии исключительно путем корректировки нашего определения гипотензии (15,8–91,4%). Мы использовали данные, собранные в условиях ограниченных ресурсов, с использованием текущих национальных рекомендаций по лечению гипотензии. Клор и его коллеги выделили 15 различных определений в 63 различных исследованиях в своем исследовании 4 , хотя большинство этих исследований были взяты из стран с высоким уровнем дохода и применимы к плановым КС.Исследования в Южной Африке показали аналогичные различия в определениях даже в пределах одной и той же единицы. Примеры определений из южноафриканской литературы включают:

  • САД < 80% исходного уровня; 23,24

  • САД < 20% исходного уровня; 25

  • САД < 90 мм рт.ст.; 26,27

  • САД < 90 мм рт.ст. или САД < 80% исходного уровня; 8

  • САД < 100 и <80% исходного уровня. 28

Рекомендации, основанные на снижении артериального давления по сравнению с исходным уровнем, основаны на точных первоначальных измерениях. Наше исследование, по-видимому, имеет более высокую частоту гипотензии при относительных определениях, чем при абсолютных определениях. Важно отметить, что исходное артериальное давление измеряли в операционной до операции; это, вероятно, привело к более высокому, чем обычно, исходному артериальному давлению, что, в свою очередь, может привести к более высокой частоте гипотензии при использовании относительных определений.На самом деле это может быть выгодно в среде, где недостаточное лечение является основной проблемой, поскольку чрезмерное лечение может уменьшить симптомы у матери. В исследованиях с использованием относительных определений требуется проявлять большую осторожность в достижении точного исходного артериального давления путем проведения нескольких измерений в спокойном, тихом месте. Маловероятно, что это будет достижимо в условиях ограниченных ресурсов и, вероятно, будет трудно даже в условиях богатых ресурсами, что признано в заявлении о консенсусе. 6 В полной когорте нашего родительского исследования у 335/506 пациентов (66%) исходное САД > 120 мм рт.ст.Это подразумевает лечение вазопрессорами на уровне выше 100  мм рт. ст., если применяются рекомендации консенсуса: потенциально более высокий уровень, чем необходимо, особенно если исходное артериальное давление ложно повышено.

Для таргетирования артериального давления в процентах от исходного уровня также требуется, чтобы лечащий анестезиолог рассчитывал это число индивидуально для каждого пациента. Повышение сложности таким образом может быть менее эффективным, чем применение последовательного абсолютного порога (либо САД, либо САД), выше которого плохие результаты маловероятны.Применение абсолютного порога является более простым методом и, возможно, его легче стандартизировать. Это может объяснить тенденцию консультантов-акушеров-анестезиологов использовать абсолютные пороги даже в Великобритании, а не относительные определения, обычно встречающиеся в литературе. 21

Комбинированные определения, по-видимому, подвержены риску завышения частоты гипотензии. Частота САД < 80 мм рт. ст. в нашем исследовании составила всего 15,8%, но в сочетании со снижением среднего АД > 30% (САД < 80 мм рт. ст. или снижение САД > 30%) частота увеличивается до 49%.Возможно, это произошло из-за более высокого базового измерения. Альтернативной стратегией является та, которую предпочитали Rout et al ., где комбинированное определение требовало соблюдения обоих определений (SBP < 100 и < 80% исходного уровня), а не только одного из двух. 28 Это гарантирует, что пациенты с более низким исходным артериальным давлением не будут ниже порога лечения даже до спинальной анестезии. Однако использование этого подхода у пациента с исходным САД 95 мм рт.ст. будет означать, что лечение будет начато только при САД 76 мм рт.ст., что большинство сочтет слишком низким.Сложность этих определений делает их маловероятными для применения в условиях ограниченных ресурсов и в районных больницах.

Стандартное определение явно было бы полезно как для исследовательских целей, так и для клинической медицины. Рекомендации в консенсусном заявлении (не допускать снижения исходного САД до  < 90% от исходного уровня и лечить ниже 80%) могут быть полезными для выполнения в исследовательских учреждениях или учреждениях, где возможны точные исходные измерения. Однако абсолютные пороги привлекательны как для простоты использования, так и для простоты понимания.Кроме того, исследования в смежных областях, таких как интенсивная терапия и внесердечная хирургия, приблизились к абсолютным пороговым значениям, хотя эти исследования могут быть неприменимы к акушерской спинальной гипотензии. Необходимы дальнейшие исследования в рамках крупных многоцентровых исследований для установления безопасного нижнего предела, позволяющего избежать исходов для матери и плода, связанных с гипоперфузией органов.

Мы предлагаем принять абсолютные определения материнской гипотензии в условиях ограниченных ресурсов, основываясь как на простоте, так и на согласованности с литературой из смежных областей периоперационной и интенсивной терапии.Представляется, что как текущая практика, так и существующие рекомендации благоприятствуют использованию САД в качестве порогового значения, и поэтому целесообразно использовать эту меру. Однако, основываясь как на физиологических соображениях, так и на параллельных исследованиях исходов, продемонстрированных в периоперационных условиях и в условиях интенсивной терапии, вполне вероятно, что пороговые значения MAP являются более подходящей целью в долгосрочной перспективе. Соответственно, у пациентов без гипертонии мы предлагаем одно из следующего:

  1. Целевое САД > 100 мм рт.ст., назначить вазопрессорную терапию ниже 90 мм рт.ст.;

  2. Целевое СрАД > 70 мм рт.ст., начать вазопрессорную терапию ниже 65 мм рт.ст.

Наше исследование имеет несколько ограничений. Мы исследовали популяцию, представляющую обычную акушерскую службу районной больницы, включая неотложное КС и не ограничиваясь здоровыми плановыми КС. Хотя это может сделать сравнение с другими исследованиями проблематичным, это преимущество в отношении обобщаемости. Еще одним ограничением является то, что мы лечили артериальное давление, когда САД было ниже 90 мм рт.ст. Таким образом, под действием лечения снижается частота случаев артериального давления ниже этого уровня.Однако было бы неэтично воздерживаться от лечения ниже безопасного уровня, и допущение снижения САД ниже 90  мм рт. ст. не соответствовало бы последним руководствам или национальным рекомендациям. Наконец, мы включили в нашу когорту пациенток с гипертензией и ожирением: измерения НИАД могут быть неточными в этих группах, 29,30 , в то время как известно, что пациентки с преэклампсией имеют более низкую частоту гипотензии. 31 Наши рекомендации не следует применять к пациентам с артериальной гипертензией.

Заключение

Этот ретроспективный анализ подтвердил широкий разброс частоты акушерской спинальной гипотензии в условиях ограниченных ресурсов, в зависимости от используемого определения.Отсутствие согласованного определения является проблемой как для исследований, так и для клинической медицины. Руководящие принципы в условиях ограниченных ресурсов должны быть простыми и удобными для пользователя: вполне вероятно, что принятие определения абсолютного порога является наиболее подходящим в наших условиях. Мы рекомендуем ориентироваться либо на САД выше 70 мм рт.ст., либо на САД выше 100 мм рт.ст., а самые низкие абсолютные значения, при которых следует начинать лечение вазопрессорами у пациенток с нормотензией во время беременности, должны составлять САД 65 мм рт.ст. или САД 90 мм рт.ст.Оптимально, несмотря на ограничение потенциальной неточности измерения исходного артериального давления, практикующие врачи должны придерживаться поддержания САД на уровне более 90% от исходного значения. Это соответствует недавно опубликованному общему мнению и направлено на снижение частоты материнских симптомов, связанных с гипотензией. 6,22 Необходима дальнейшая работа, чтобы установить влияние соблюдения этих рекомендаций на важные исходы для матери и плода.

Рисунок 1. Частота гипотензии по абсолютному определению САД. Примечание: САД =систолическое артериальное давление.

Таблица 1: частота гипотензии с использованием абсолютных значений кровяного давления

4 8 0

11.8-20.9
Absolute BP-определение Заболеваемость 95% Доверительный интервал
SBP 100 мм рт.ст. 49% 42.9-55.2
<90 MMHG 32,8%
<80 мм Z <80 MMHG 15.8-20.9
карта <70 MMHG 60,5% 54.3-66.4
<65 мм рт.ст. 49,4% 43.3-55.6
<60 мм рт.ст. 34,4% 28.8-40.5

Таблица 2: Заболеваемость гипотензией с использованием относительных значений кровяного давления

95% 40060 0 6 953 <20%

BP Определение относительно базового уровня
SBP <30 % 27.3% 22.1-33.1
3 <20% 49,0% 49,0%
3 <10% 75,4-80038 69,4-80,1
карта <30% 47,4% 41.3-58 9 41.3-53.6
75.5% 75,5%
<10% 91,4% 87.1-94.2

Таблица 3: Частота гипотензии с использованием композиционных определений

4 925 Заболеваемость гипотомией 0 0
95% доверительный интервал
<30% карта или < 80 мм рт.ст. САД 49.0% 42.9-55.2
<20% карта или <90mmhg SBP 77,1% 71.5-81.9

Таблица 4: Разрешения гипотензии к периоду времени

5 Spinal до 15 минут Пост-доставка 0
BP Определение Спинал до доставки Доставка до 15 минут Доставка
3 SBP <100 MMHG 49.0% (42.9-55.2) 34,8% (29.1-40.9) 58,1% (51,9-64,1)
SBP <20% 49,0% (42.9-55.2) 38,3% (32.5-44,5 ) 60,9% (54.7-66.7)
SBP <100 мм ZMHG или SBP <20% 57,3% (51.1-63.3) 47,4% (41.3-53.6) 69,6% (63,6-75,0)

Влияние изобарического и гипербарического бупивакаина на гемодинамические изменения у матери после спинальной анестезии при плановом кесаревом сечении: проспективное когортное исследование

Аннотация

Фон

Спинальная анестезия — это форма регионарной анестезии, часто используемая при различных абдоминальных, ортопедических, акушерских операциях, таких как кесарево сечение.Наиболее распространенным местным анестетиком, используемым для спинномозговой анестезии в акушерской и неакушерской хирургии, является бупивакаин, который можно использовать в виде изобарического или гипербарического раствора, вызывая различия в гемодинамических изменениях у матери. На этом фоне исследование направлено на сравнение эффектов изобарического и гипербарического бупивакаина на гемодинамические изменения у матери после проведения спинальной анестезии для планового кесарева сечения в Мемориальном госпитале Ганди, Аддис-Абеба, Эфиопия.

Методы

В период с 1 декабря 2017 г. по 30 января 2018 г. применялся дизайн проспективного когортного исследования на базе больницы.Всего было задействовано 100 рожениц, одна группа подвергалась воздействию изобарического бупивакаина, а другая — гипербарического бупивакаина для наблюдения за их влиянием на гемодинамические изменения матери после спинальной анестезии. Участники были отобраны путем систематической случайной выборки. Анализ данных проводили с использованием SPSS (версия 20) с помощью описательной статистики, использовали t-критерий независимой выборки, U-критерий Манна-Уитни, точный критерий Фишера и критерий хи-квадрат. Значения P <0,05 считались статистически значимыми для всех тестов.

Результаты

Было обнаружено, что частота гипотонии выше в изобарической, чем в гипербарической группах (82% против 60% соответственно; p = 0,015). Статистически значимых различий в среднем значении артериального давления на исходном уровне обнаружено не было, но статистически значимые изменения наблюдались среди групп (p < 0,05) на всех сроках исследования после спинальной анестезии, кроме 30 th мин. Статистически значимых различий в средней вариабельности сердечного ритма после спинальной анестезии не выявлено на всех сроках, кроме 15-й минуты ( р = 0.033). В изобарической группе применяли большее количество вазопрессоров по сравнению с гипербарической группой (36% против 14% соответственно; p = 0,011).

Заключение

Баричность является важным фактором материнских гемодинамических изменений у рожениц при плановом кесаревом сечении. Изобарический бупивакаин вызывает большее изменение артериального давления и частоту гипотензии и влечет за собой большую потребность в вазопрессорах, чем гипербарический бупивакаин после спинальной анестезии при плановом кесаревом сечении.

Образец цитирования: Helill SE, Sahile WA, Abdo RA, Wolde GD, Halil HM (2019)Влияние изобарического и гипербарического бупивакаина на гемодинамические изменения матери после спинальной анестезии для планового кесарева сечения: проспективное когортное исследование. ПЛОС ОДИН 14(12): е0226030. https://doi.org/10.1371/journal.pone.0226030

Редактор: Ehab Farag, Cleveland Clinic, США

Получено: 29 сентября 2019 г.; Принято: 17 ноября 2019 г.; Опубликовано: 12 декабря 2019 г.

Авторское право: © 2019 Helill et al.Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные содержатся в документе и в его файлах вспомогательной информации.

Финансирование: Университет Аддис-Абебы финансировал исследование, и исследователи могут опубликовать рукопись. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Сокращения: АСА, Американское общество анестезиологов; ИМТ, Индекс массы тела; бакалавр наук, Бакалавр; цена за день, Цефалотазовая диспропорция; КОМПАКТ ДИСК, кесарево сечение; ЦСЖ, Спинномозговая жидкость; Лос-Анджелес, местные анестетики; КАРТА, Среднее артериальное давление; Магистр, магистры наук; ПИ, Главный следователь; ЮАР, Спинномозговая анестезия; СБП, Систолическое кровяное давление

Введение

Спинальная анестезия (СА) — форма регионарной анестезии (РА), часто используемая при различных абдоминальных, ортопедических и акушерских операциях, включая кесарево сечение (КД) [1–4].Наиболее распространенным анестетиком, используемым для СА в акушерской и неакушерской хирургии, является бупивакаин, который может быть приготовлен в виде изобарического или гипербарического раствора [5–7].

Кесарево сечение обычно выполняется под СА с использованием гипербарического бупивакаина. Это было связано с увеличением частоты тяжелой гипотензии [8]. Изобарический бупивакаин обычно не используется при СА, но может быть хорошей альтернативой в акушерстве из-за его более низких гемодинамических изменений у матери [9]. Помимо объема, концентрации и дозы баричность раствора может влиять на профиль спинальной блокады [10–13].

Считается, что различия в баричности растворов спинальных анестетиков влияют на гемодинамические параметры и распределение в субарахноидальном пространстве, что, в свою очередь, может влиять на начало, степень и продолжительность сенсорного блока, а также на побочные эффекты [14].

Принято считать, что гипербарические растворы более подходят для достижения верхних грудных дерматомов, чем их простые эквиваленты [15]. Целью всех анестезиологов является выполнение СА с наименьшим отклонением артериального давления и частоты сердечных сокращений, при условии, что гемодинамически пациент до операции был в норме.При этом используют РА различной баричности [16].

Гипотензия является наиболее частым последствием нейроаксиальной анестезии, в основном в акушерской хирургии. Распространенность артериальной гипотензии у акушерских пациенток при СА, особенно при БК, составляет 80–90% [8]. Гипотензия вызывает неприятные симптомы, такие как тошнота и рвота, брадикардия, потеря сознания, угнетение дыхания и остановка сердца у матерей, перенесших болезнь Крона. При тяжелых и длительных состояниях это приводит к нарушению маточной перфузии и, в конечном счете, к ацидозу плода и депрессии новорожденного [17, 18].

Факторы, повышающие риск гипотензии, включают факторы пациента (пожилой возраст, женский пол, беременность, ожирение, сахарный диабет, гипертензия, анемия) и технические факторы, такие как уровень блока на уровне T5 или выше, барическая активность препаратов, использование опиоиды в качестве премедикации и высокие дозы РА [19, 20].

Опубликованные данные показывают, что были предприняты различные меры для уменьшения спинно-индуцированной гипотензии у беременных, перенесших плановую CD, например наклон влево; внутривенная предварительная или совместная загрузка жидкостью; подъем ноги; профилактическое применение вазопрессоров, однако частота гипотензии остается высокой [21, 22].Были рекомендованы дополнительные исследования для определения относительного влияния баричности регионарных анестетиков на характеристики спинальной блокады, особенно у рожениц. Насколько нам известно, в Эфиопии нет опубликованных исследований, показывающих влияние изобарического и гипербарического бупивакаина на гемодинамические изменения у матери. Таким образом, исследование направлено на сравнение влияния изобарического и гипербарического бупивакаина на гемодинамические изменения матери после введения спинальной анестезии для планового кесарева сечения в Мемориальном госпитале Ганди, Аддис-Абеба, Эфиопия.

. Методы и материалы. Исходную популяцию составили беременные женщины, которым в период исследования была проведена плановая ДК. Исследуемая популяция состояла из отобранных беременных матерей, которым в течение периода исследования была проведена факультативная CD. Критериями включения были: всем женщинам в период исследования было выполнено плановое кесарево сечение.С другой стороны, из исследования исключались матери с системными и психологическими расстройствами, матери с осложнениями беременности, экстренным БК, неудачной спинальной блокадой, наличием противопоказаний к спинальной анестезии и аллергией на РА.

Беременные матери, перенесшие элективный CD с изобарическим раствором, составили группу, подвергшуюся воздействию, а те, кто подвергся гипербарическому бупивакаину, составили группу, не подвергшуюся воздействию. Размер выборки был рассчитан с использованием формулы двойной доли населения. Следующие предположения были использованы для оценки размера выборки; заболеваемость гипотензией была взята из предварительных данных из Ирана (42% в группе, не подвергавшейся воздействию, и 70% в группе, подвергшейся воздействию) [23], с доверительным интервалом 95%, желаемой точностью 5% и мощностью 80%, выборка размер был 100 (50 на группу).Для отбора участников исследования из каждой группы использовался метод систематической случайной выборки. Из всех запланированных рожениц, которые соответствовали критериям включения в список операций для проведения кесарева сечения, выборки были отобраны с пропуском каждого 2-го интервала. Первая роженица выбиралась методом лотереи из первых двух графиков. На основании решения анестезиологов отобранные роженицы помещались в любую группу до тех пор, пока не был заполнен необходимый объем выборки.

Данные были собраны с использованием предварительно протестированных структурированных вопросников.Для сбора данных и наблюдения были наняты анестезиологи, двое со степенью бакалавра и один со степенью магистра. Предоперационная оценка была проведена за день до операции, чтобы сохранить NPO, выполнить необходимые исследования, основанные на данных анамнеза, и провести физикальное обследование с помощью стационарных анестезиологов. Рано утром была проверена работоспособность оборудования операционной и подготовлены необходимые препараты. Перед тем, как роженица вошла в операционную, дежурные анестезиологи, назначенные для больничной программы, проанализировали карту, включая социально-демографическую идентификацию, материнские характеристики и показания для CD.Всем роженицам вводили предварительно 0,9% NS 10–20 мл/кг. Премедикация 1 г цефтриаксона и 10 мг метоклопрамида в/в вводилась по прибытии в зону ожидания операционной.

Процедура в операционной включала стандартный мониторинг с неинвазивным мониторингом артериального давления, электрокардиограммой (ЭКГ) и пульсоксиметрией. Исходное артериальное давление и частоту сердечных сокращений измеряли за пять минут до введения спинальной анестезии. Во всех асептических условиях спинномозговая анестезия проводилась в положении сидя, используя передний верхний гребень подвздошной кости в качестве поверхностного ориентира с помощью спинальной иглы 25-G на уровне межпространственного пространства L3-4.После правильного размещения иглы, определяемого по свободному оттоку спинномозговой жидкости, в течение десяти секунд вводили 12,5 мг бупивакаина.

Сразу после спинальной инъекции роженицам осторожно помогали лечь на спину, сохраняя 15 0 смещение матки влево. Пациентов наблюдали в течение 30 минут после введения СА. Сборщики данных регистрировали жизненные показатели каждые 5 минут на протяжении всей операции, а успех спинальной анестезии оценивали по симпатической блокаде, снижению двигательной функции.Уровень сенсорной блокады оценивали путем наложения марли со льдом на кожу матери и документировали. У рожениц, у которых развилась гипотензия и которые не могли корректироваться с помощью жидкости и положения, для лечения гипотензии применяли 5 мг эфедрина внутривенно болюсно. Гипотензия: В этом исследовании гипотонию определяли как снижение систолического артериального давления на 25% по сравнению с донаркозным значением после введения спинальной анестезии.

Качество данных, поддерживаемых с помощью вопросников, было предварительно протестировано на 5% размера выборки в специализированной больнице Black Lion, и были внесены необходимые изменения в зависимости от характера пробелов, выявленных в вопроснике.Кроме того, исследователи в течение дня знакомили сборщиков данных и супервайзеров с содержанием анкеты. Кроме того, руководители и исследователи внимательно следили за ежедневным процессом сбора данных во время предварительного тестирования и фактического сбора данных.

Обработка и анализ данных

Данные были введены и проанализированы с помощью SPSS версии 20.0. Описательная статистика (т. е. частота, процент, медиана, среднее значение и стандартное отклонение) применялась для описания структуры данных.Кроме того, нормальность количественных данных оценивали с помощью критериев Шапиро-Уилка и Колмогрова-Смирнова, а однородность — с помощью критерия равенства дисперсий Леванеса. Использовали t-критерий независимых выборок, U-критерий Манна-Уитни, критерий хи-квадрат и точный критерий Фишера. Значения P <0,05 считались статистически значимыми для всех тестов.

Одобрение этики и согласие на участие

Письмо об этическом разрешении было получено от Институционального наблюдательного совета Университета Аддис-Абебы, комитета по этике отдела анестезиологических исследований.Кроме того, было получено разрешение от администрации мемориальной больницы Ганди. Наконец, письменное информированное согласие было получено от каждого участника, который был включен в исследование во время сбора данных, после объяснения им целей исследования. Кроме того, конфиденциальность поддерживалась за счет того, что не запрашивались личные идентификаторы, такие как имя и адрес.

Результаты

Демографические, периоперационные характеристики рожениц

Всего в исследование было включено 100 женщин, перенесших БК.В этой группе 50 рожениц принимали изобарическую и 50 рожениц гипербарическую. Не наблюдалось статистически значимых различий между группами по возрасту, массе тела, росту, ИМТ, статусу ASA, паритету, гестационному возрасту, показаниям для БК, уровню сенсорного блока, количеству использованной жидкости, объему кровопотери, исходному САД и исходному уровню. ЧР. Большинству рожениц было проведено плановое кесарево сечение с указанием на предшествующую БК (56% в группах гипербарической и 62% в группе изобарической) (Таблица 1) .

Гемодинамические характеристики рожениц

Частота систолической гипотензии после проведения спинномозговой анестезии составила 62% [95% ДИ, 46%-74%] в группе гипербарической и 82% в группе изобарической с X 2 = 5,90. Между группами наблюдались статистически значимые различия (p = 0,015). В то время как в изобарической группе наблюдалась более высокая частота гипотензии, чем в гипербарической, не было статистических различий в среднем значении СрАД на исходном уровне.После проведения спинальной анестезии статистически значимые изменения наблюдались среди групп (p < 0,05) во все сроки исследования, кроме 30 мин. Снижение среднего артериального давления было более распространенным в изобарической группе, чем в гипербарической, с 5   до 25   минут 91 205 (рис. S1).

Статистически значимых различий в средней вариабельности ЧСС после введения спинальной анестезии на всех сроках исследования между группами не наблюдалось, кроме 15 мин.Достоверно большая вариабельность сердечного ритма зарегистрирована в изобарической группе на 15 й мин, чем в гипербарической группе после введения спинальной анестезии по сравнению с исходными значениями (р = 0,033). Поскольку ни у одного из клиентов не развилась брадикардия, дополнительного введения атропина не потребовалось (таблица 2).

Влияние изобарического и гипербарического бупивакаина на уровень сенсорной блокады

Уровни сенсорного блока наблюдались среди групп, и у большинства клиентов был уровень сенсорного блока Т8 в группе гипербарического лечения (64%) и уровень сенсорного блока Т6 в группе изобарического лечения (62%).Уровень сенсорного блока Т4 и выше наблюдался у 3 клиентов из изобарической группы (6%) и ни у одного из гипербарической группы. Уровень сенсорной блокады Т10 наблюдался у 6% изобарических и у 2% гипербарических групп. Были статистически значимые различия в уровне сенсорной блокады между группами (p = 0,001) (S2 Fig).

Частота потребления вазопрессоров между группами и интраоперационные осложнения у матери

Уровень потребности в эфедрине был относительно выше в группе изобарического лечения 18 (36%), чем в группе гипербарического лечения 7 (14%) для лечения гипотензии, и это является статистически значимым (p = 0.011). Тошнота и рвота были наиболее частыми осложнениями у матери, на долю которых приходилось 44% в изобарической и 20% в гипербарической группах всех осложнений. Относительно более высокие материнские осложнения наблюдались в отношении тошноты и рвоты, головокружения и угнетения дыхания в изобарической группе. Это было статистически значимо между группами (p = 0,001).

Обсуждение

В этом исследовании было обнаружено, что частота гипотензии выше в изобарической группе, чем в гипербарической (82% против60%; р = 0,015). Между группами наблюдались статистически значимые различия. Аналогичные результаты были также получены в исследовании, проведенном в Пакистане [24] и в Турции [25]. Напротив, это исследование выявило более высокую частоту гипотензии в изобарической, чем в гипербарической группах по сравнению с исследованиями, проведенными в Иране [23], Великобритании [26] и Уэльсе [27]. Эти различия могут быть связаны с разницей в положении, высоте блока, кривизне позвоночника, социально-демографических характеристиках и опыте анестезиологов.

Статистически значимых различий в среднем значении MAP на исходном уровне не было, но после спинальной анестезии статистически значимые изменения наблюдались между группами во все сроки исследования, за исключением 30 th минут. Снижение среднего артериального давления в этом исследовании наблюдалось больше в изобарической, чем в гипербарической группах от 5 до 25 минут. Напротив, другие исследования, проведенные в Боснии и Герцеговине [7] и Уэльсе [27], выявили большее снижение среднего артериального давления у гипербарических, чем у изобарических групп.Эти различия могут быть связаны с положением и ростом роженицы, объемом используемых местных анестетиков, возможностью обезвоживания и количеством используемых вазоактивных препаратов.

Кроме того, значительно более высокая вариабельность частоты сердечных сокращений (ЧСС) была зарегистрирована в изобарической группе на 15 th минут, чем в гипербарической группе по отношению к исходным значениям. Этот вывод контрастирует с исследованием, проведенным в Индонезии [28], в котором не сообщалось о существенных различиях в вариабельности ЧСС между группами.С другой стороны, наш результат не согласуется с исследованием, проведенным в Боснии и Герцеговине [7], в котором сообщалось о значительном снижении частоты пульса в группах с гипербарическим давлением по сравнению с группами с изобарическим давлением. Это различие может быть связано с блокадой симпатических ускорительных волокон и высоким уровнем сенсорная блокада.

Это исследование выявило более высокий уровень сенсорной блокировки в изобарических группах. Это подтверждается исследованиями, проведенными в Индонезии [28]. Это контрастировало с тем, что наблюдалось в Иране [23], где уровень сенсорной блокировки был ниже в изобарических группах.Наблюдаемое различие могло быть связано с тем, что принятие положения лежа на спине, даже с наклоном влево, вызывает компрессию нижней полой вены, что, в свою очередь, приводит к набуханию эпидурального венозного сплетения. Последующая компрессия дурального мешка может способствовать перемещению больших количеств препаратов, введенных в спинномозговую жидкость, и может объяснить краниальное продвижение изобарического введения бупивакаина.

В этом исследовании в изобарических группах требовалось большее количество эфедрина. Однако, в отличие от того, что было обнаружено в Уэльсе [27] и Иране [23], потребность в эфедрине не была выше в группе гипербарической терапии в этом исследовании.

Наиболее частыми осложнениями у матери были тошнота и рвота, на долю которых приходилось 44% в изобарической и 20% в гипербарической группах всех осложнений. Возникновение тошноты и рвоты могло быть вторичным по отношению к гипотензии, которая эффективно купировалась введением жидкости и эфедрина в качестве вазопрессора. В отличие от нашего результата исследования, проведенные в Соединенном Королевстве и Пакистане, обнаружили незначительные различия в частоте возникновения тошноты и рвоты [10, 24]. Это может быть связано с разной частотой гипотензии, гиперактивности блуждающего нерва, висцеральной боли, применения утеротонических препаратов и симпатэктомии.

Достоверность исследования : Участники исследования были отобраны с использованием метода вероятностной выборки, чтобы обеспечить его репрезентативность, и для поддержания качества данных использовались различные подходы. Отсутствие потерь рожениц, которые привели к отсутствию данных для дальнейшего наблюдения. Ограничениями исследования являются недоступность инвазивного измерения артериального давления для измерения систолического артериального давления у родильниц от удара к удару. Начало и продолжительность сенсорной и моторной блокады не оценивали.Продолжительность гипотензии не может быть измерена при каждом гипотензивном эпизоде ​​из-за того, что неинвазивный мониторный прибор корректируется каждые 5 минут в условиях стационара.

Заключение

Баричность является важным фактором материнских гемодинамических изменений у рожениц при плановом кесаревом сечении. Изобарический бупивакаин вызывает большее изменение артериального давления и частоту гипотензии и влечет за собой более высокую потребность в вазопрессорах, чем гипербарический бупивакаин после спинальной анестезии при плановом кесаревом сечении.

Благодарности

Мы выражаем благодарность Университету Аддис-Абебы, руководству и персоналу Мемориальной больницы Ганди, руководителям, сборщикам данных и респондентам, принявшим участие в этом исследовании.

Каталожные номера

  1. 1. Wong JO, Tan TD, Leung P, Tseng K, Cheu N. Сравнение эффекта двух различных доз 0,75% безглюкозного ропивакаина для спинномозговой анестезии при хирургии нижних конечностей и нижней части брюшной полости. Гаосюн J Med Sci 2004 20 9.
  2. 2. Урмей ВФ. Спинальная анестезия при амбулаторных операциях. Best Pract Res Clin Anaesthesiol 2003; 17: 335–46. пмид:14529006
  3. 3. Иохом БДОДГ. Техники регионарной анестезии в амбулаторной ортопедической хирургии. пмид:187. 2008;21(6):723–8.
  4. 4. Stamer UM, Stüber F, Wulf H, Meuser T. Изменения в анестезиологической практике при кесаревом сечении в Германии. Acta Anaesthesiol Scand. 2005 49 (2): 170–6. пмид:15715617
  5. 5. Бирнбах диджей.Анестезия в акушерстве. В: Миллер Р.Д., редактор. Анестезия Миллера. Филадельфия: Черчилль Ливингстон;. Европейский журнал анестезиологии (EJA). 2010.; 31 (188): 2203–40.
  6. 6. Chestnut D, Wong C, Tsen L, Beilin Y, Mhyre J. Акушерская анестезия Chestnut: Принципы и практика. Филадельфия: ЭЛЬСЬЕР. 2009: 4-е изд.
  7. 7. Солакович Н. Сравнение гемодинамических эффектов гипербарического и изобарического бупивакаина при спинальной анестезии. МЕД АРХ. 2010 г.; 64(1):11–4 вечера:20422816
  8. 8.Ayorinde BT, Buczkowski P, Brown J, Shah J, Buggy DJ. Оценка упреждающего внутримышечного введения фенилэфрина и эфедрина для снижения гипотензии, вызванной спинальной анестезией, во время кесарева сечения. Бр Джей Анаст. 2001 г.; 86:372–6. пмид:11573527
  9. 9. Хуссейн, доктор медицины, Маллик, МТ. Эффекты изобарического бупивакаина при эндоскопических урологических операциях под спинальной анестезией. JAFMC Бангладеш. 2011 г.; 7:33–6.
  10. 10. Луберт С.Ф., Холворт С., Фернандо Р., Колумб М.Ф., Патель Н., Саранг К. и др.Влияет ли баричность бупивакаина на интратекальное распространение при длительном положении сидя перед плановым кесаревым сечением? Проспективное рандомизированное контролируемое исследование. www.анестезия-анальгезия.org. 2011 113 4. пмид:218
  11. 11. Danelli G, Di Cianni S, ZasaM md, De Marco G, Adamanti S. Влияние баричности 0,5% или 0,75% левобупивакаина на время начала спинальной анестезии: рандомизированное исследование. АН ДЖАНЕСТ 2008; 55: 8.
  12. 12. Малиновский Дж.М., Рено Г., Корре П.Л., Фарм Д., Чарльз Ф.С., Малинж М. и соавт.Intratbecal Bupiuacaine in Humans Влияние объема и баричности растворов. Анестезиология. 1999; 9I (1260–1266).
  13. 13. Уэйсон Р. Сравнение гипобарического, почти изобарического и гипербарического бупивакаина для спинальной анестезии у пациентов, перенесших артроскопию коленного сустава. Васон, Гогия. ахни; рупа: 445–8: сост.
  14. 14. Ричардсон М.Г., Висслер Р.Н. Интратекальное гипобарическое и гипербарическое введение бупивакаина с морфином при кесаревом сечении. Анест Аналг 1998; 87: 336–40. пмид:9706927
  15. 15.Bigler D MI, Hjortso NC. Двойная слепая оценка интратекального гипербарического и безглюкозного бупивакаина на обезболивание и сердечно-сосудистую функцию. Рег Анест 1986; 11: 151–5.
  16. 16. Эренфельд Дж.М., Урман Р.Д. Segal S Anesthesia Student Survival Guide. Индивидуальный подход. Швейцария: Springer International Publishing 2016: 2-е изд. https://doi.org/10.1007/978-3-319-11083-7
  17. 17. Наз Ф., Бегум А., Малик М., Зарин А. Осложнение спинномозговой анестезии при кесаревом сечении.Пакистанский журнал медицинских и медицинских наук, 2010 г.; 4:3.
  18. 18. Сингх М., Шамса М. Влияние скорости введения гипербарического бупивакаина на спинальный блок у рожениц: рандомизированное исследование. МОЖЕТ ДЖЕН АНЕСТ. 2007 54 (4): 290–5. пмид:17400981
  19. 19. Бренк Ф., Катцер С., Обейд Р., Брюггманн Д., Бенсон М., Рериг Р., Юнгер А. Гипотензия после спинальной анестезии при кесаревом сечении: выявление факторов риска с использованием системы управления информацией об анестезии.Журнал клинического мониторинга и вычислений 2009; 23: 85–92. пмид:19277879
  20. 20. Хартманн Б., Класен Дж., Бенсон М., Йост А., Банцхаф А., Хемпельманн Г. Заболеваемость и факторы риска гипотонии после индукции спинномозговой анестезии: анализ с автоматическим сбором данных. Анест Аналг 2002; 94: 1521–159. пмид:12032019
  21. 21. Атеф К. Салама HMG, Бассант М. Абдель Хамид. Предварительная нагрузка жидкостью по сравнению с эфедрином при лечении гипотензии, вызванной спинальной анестезией, у рожениц, перенесших кесарево сечение: сравнительное исследование.Журнал анестезиологии Айн-Шамс 2016; 9:72–5.
  22. 22. Сиддик-Сайид СММ, Вивиан Г., Самар, Збейде РАМС К., Жюль-Мари А. Алами Ал, и др. Рандомизированное исследование, сравнивающее коллоидную преднагрузку с конагрузкой во время спинномозговой анестезии для планового кесарева сечения. Октябрь 2009 г. 109 (4): 1219–24. пмид:19641050
  23. 23. Аташхои С.М., Абедини Н.М., Пурфати Х.М., Бахрами А.З., Хатами П.М. Влияние бупивакаина на материнскую гемодинамику после спинальной анестезии при кесаревом сечении: рандомизированное контролируемое исследование.Иран J Med Sci. 2017;42:2.
  24. 24. Афтаб Х.А. С., Зафар С. и др. интратекальный изобарический или гипербарический бупивакаин при плановом кесаревом сечении. Пакистанский журнал хирургии. 2007; 23(4).
  25. 25. Топташ М., Узман С., Ишитемиз И., Янарал Т.Ю., Аккоч И., Бикан Г. Сравнение влияния гипербарической и изобарической спинальной анестезии бупивакаином на гемодинамику и вариабельность сердечного ритма. Турецкий журнал медицинских наук, 2014 г.; 44: 224–231. пмид:25566589
  26. 26.Холворт С., Рошан Ф., Колумб М.О. Влияние позы и баричности на распространение интратекального бупивакаина для планового кесарева сечения. Акушерская анестезия: исследовательский отчет. 2005 г.; 100 (4): 1159–1165.
  27. 27. Кричли Л.А., Деррик Дж. Влияние баричности на гемодинамические эффекты интратекального бупивакаина 0,5%. 1999; 54: 469–74. пмид:10995146
  28. 28. Helmi M, Uyun Y, Suwondo BS и Widodo U. Сравнение интратекального применения изобарического и гипербарического бупивакаина во время операции на нижней части живота.J Anesthesiol 2014. 2014: 1–4.

Общая и спинальная анестезия во время кесарева сечения: описательный обзор

1. Мюррей Э., Марк Дж. Руководство по эффективной помощи при беременности и родах. Оксфорд: Университетское издательство; 2000.
2. Лю С., Листон Р.М., Джозеф К., Химан М., Сове Р., Крамер М.С. Материнская смертность и тяжелая заболеваемость, связанные с плановым кесаревым сечением низкого риска по сравнению с плановыми вагинальными родами в срок. CMAJ.2007 г.; 176(4):455-60.
3. Андерсен Х.Ф., Остер Г.Х., Маркс Г.Ф., Меркатц И.Р. Неонатальный статус в зависимости от интервалов разрезов, акушерских факторов и анестезии при кесаревом сечении. Ам Дж. Перинатол. 1987 год; 4(04):279-83.
4. Graham D, Russell I. Двойная слепая оценка обезболивающего эффекта интратекального диаморфина (0,3 мг) при спинальной анестезии при плановом кесаревом сечении. Int J Obstet Анест. 1997 год; 6(4):224-30.
5. Thorp J, Laughon S. Клинические аспекты нормальных и ненормальных родов.Медицина матери и плода: принципы и практика, 6-е изд., Филадельфия, Пенсильвания: Saunders Elsevier. 2009: 453-76.
6. Розен М. Акушерская анестезия и обезболивание. Текущее мнение в анестезиологии. 1994;7(3):219-20.
7. Эндрюс В.В., Рамин С.М., Маберри М.С., Ширер В., Блэк С., Уоллес Д.Х. Влияние вида анестезии на кровопотерю при плановом повторном кесаревом сечении. Ам Дж. Перинатол. 1992 год; 9(03):197-200.
8. Висальяпутра С., Роданант О., Сомбунвибун В., Тантивитаятан К., Тиентонг С., Сенгчоте В.Спинальная и эпидуральная анестезия при кесаревом сечении при тяжелой преэклампсии: проспективное рандомизированное многоцентровое исследование. Анест Анальг. 2005;101(3):862-8.
9. Макартур А., Райли Э.Т. Споры об акушерской анестезии: выбор вазопрессоров при постспинальной гипотензии во время кесарева сечения. Международные клиники анестезиологии. 2007;45(1):115-32.
10. Браунридж П. Спинномозговая анестезия в акушерстве. Британский журнал анестезии. 1991;67(5):663.
11. Нг К.В., Парсонс Дж., Сина А.М., Миддлтон П.Сравнение спинальной и эпидуральной анестезии при кесаревом сечении. Кокрановская библиотека. 2004 (2).
12. Хокинс Дж.Л., Кунин Л.М., Палмер С.К., Гиббс С.П. Смерти, связанные с анестезией, при акушерских родах в США, 1979–1990 гг. Анестезиология. 1997;86(2):277-84.
13. Хиббард Б., Андерсон М., Дрифе Дж., Тиге Дж., Гордон Г., Уиллаттс С. Смерти, связанные с анестезией. Отчет о конфиденциальных расследованиях случаев материнской смертности в Соединенном Королевстве. 1991;1993:87-102.
14. Эзри Т., Шмук П., Эврон С., Гева Д., Хагай З., Кац Дж.Трудные дыхательные пути при акушерской анестезии: обзор. Акушерство Gynecol Surv. 2001 г.; 56(10):631-41.
15. Loo C, Dahlgren G, Irestedt L. Неврологические осложнения при акушерской регионарной анестезии. Int J Obstet Анест. 2000 г.; 9(2):99-124.
16. Карармаз А., Кая С., Турханоглу С., Озиилмаз М. Какой путь введения фентанила лучше способствует распространению спинномозговой анестезии: внутривенный, интратекальный или оба? Acta Anaesthesiol Scand. 2003 г.; 47(9):1096-100.
17. Гадсден Дж., Харт С., Сантос А.С.Обезболивание после кесарева сечения. Анест Анальг. 2005; 101 (5S): S62-S9.
18. Cardoso MM, Carvalho JC, Amaro AR, Prado AA, Cappelli EL. Небольшие дозы интратекального морфина в сочетании с системным диклофенаком для купирования послеоперационной боли после кесарева сечения. Анест Анальг. 1998;86(3):538-41.
19. Блум С.Л., Спонг С.Ю., Вайнер С.Дж., Лэндон М.Б., Роуз Д.Дж., Варнер М.В. и др. Осложнения анестезии при кесаревом сечении. Акушерство Гинекол. 2005;106(2):281-7.
20. Ранасингхе Дж., Стедман Дж., Тояма Т., Лай М.Комбинированная спинально-эпидуральная анестезия лучше, чем только спинальная или эпидуральная анестезия при кесаревом сечении. Бр Джей Анаст. 2003;91(2):299-300.
21. Чой П.Т., Галински С.Е., Такеучи Л., Лукас С., Тамайо С., Джадад А.Р. ПГБ является частым осложнением нейроаксиальной блокады у рожениц: метаанализ акушерских исследований. Джан Джей Анаст. 2003;50(5):460-9.
22. Дуглас М., Уорд М., Кэмпбелл Д., Брайт С., Меррик П. Факторы, влияющие на возникновение постпункционной головной боли при использовании иглы Whitacre 25 калибра для акушерской анестезии.Int J Obstet Анест. 1997;6(4):220-3.
23. Морвуд Г.Х. Рациональный подход к причинам, профилактике и лечению постпункционной головной боли. CMAJ. 1993;149(8):1087.
24. Smith E, Thorburn J, Duckworth R, Reid J. Сравнение игл Whitacre 25 G и 27 G для кесарева сечения. Анестезия. 1994;49(10):859-62.
25. Хатфалви Б.И. Постулированные механизмы постдуральной пункционной головной боли и обзор лабораторных моделей. Клинический опыт. Рег Анест. 1995;20(4):329-36.
26. Ситцман Б.Т., Дядюшки Д.Р. Влияние типа иглы, калибра и изгиба кончика на отклонение спинальной иглы. Анест Анальг. 1996;82(2):297-301.
27. Ан В.С., Бахк Дж.Х., Лим Ю.Дж., Ким Ю.К. Влияние размера интродьюсера, дизайна и направления скоса на отклонение спинальных игл. Анестезия. 2002;57(10):1007-11.
28. Копач Диджей, Аллен Х.В. Сравнение отклонения иглы при регионарной анестезии на лабораторной модели. Анестезия и обезболивание. 1995;81(3):630-3.
29. Афолаби Б.Б., Леси Ф., Мерах Н.А. Регионарная и общая анестезия при кесаревом сечении. Кокрановская система базы данных, ред. 2006; 4.
30. Коуп RW. Дело Вулли и Роу; Вулли и Роу против Министерства здравоохранения и других. Анестезия. 1954 год; 9(4):249-70.
31. Котелко Д.М., Дейли П.А., Шнайдер С.М., Розен М.А., Хьюз С.К., Бризгис Р.В. Эпидуральная морфиновая анальгезия после кесарева сечения. Акушерство Гинекол. 1984;63(3):409-13.
32. Спротт Г., Шедель Р., Паджунк Х., Паджунк Х.Eine atraumatische Universalkanüle für einzeitige Regionalanaesthesien Klinische Ergebnisse nach sechsjähriger Erprobung bei über 30000 Regionalanaesthesien. Дер Анестезиолог. 1987;36(7):104-8.
33. Афолаби Б.Б., Леси Ф.Э. Регионарная и общая анестезия при кесаревом сечении. Кокрановская библиотека. 2012 г.; 10:CD004350.
34. Абдалла М.В., Эльзайят Н.С., Абдельхак М.М., Гадо А.А.М. Сравнительное исследование общей анестезии по сравнению с комбинированной спинально-эпидуральной анестезией у плода при кесаревом сечении.Египетский журнал анестезии. 2014;30(2):155-60.
35. Elgebaly AS, Elhawary T. Общая анестезия по сравнению с комбинированной спинальной эпидуральной анестезией при наличии перикардиального выпота от легкой до умеренной степени: исследование добровольцев, перенесших кесарево сечение. Египетский журнал анестезии. 2013; 29(1):19-24.
36. Исмаил С., Худа А. Наблюдательное исследование анестезии и времени хирургического вмешательства при плановом кесаревом сечении: спинальная анестезия по сравнению с общей анестезией. Int J Obstet Анест.2009;18(4):352-5.
37. Девро С., Ван де Вельде М., Рекс С. Общая анестезия при кесаревом сечении. Курр Опин Анаэстезиол. 2015;28(3):240-6.
38. Мартин Т., Белл П., Огунбии О. Сравнение общей анестезии и спинномозговой анестезии при кесаревом сечении в Антигуа и Барбуда. West Indian Med J. 2007;56(4):330-3.
39. Арндт М., Бенад Г. Риски анестезии при акушерских вмешательствах. Анестезиол Реаним. 1994;19(4):88-94.

Рынок инъекционных бупивакаина достигнет 1447 миллионов долларов США к

Нью-Йорк, США, 8 апреля 2022 г. (GLOBE NEWSWIRE) — Доля мирового рынка инъекций бупивакаина составила 721 доллар США.68 миллионов в 2017 году, согласно новому отчету StraitsResearch. Прогнозируется, что среднегодовой темп роста этого показателя с 2020 по 2030 год увеличится на 5,6%. Они используются для обезболивания определенной части тела до, во время или после операции, других процедур, родов или стоматологических работ. Он также используется для обезболивания плеча на срок до 72 часов после операции.Он вызывает онемение и облегчение боли за счет подавления импульсов на нервных окончаниях и не приводит к потере сознания.

Рынок инъекций бупивакаина делится на типы, конечных пользователей и регионы. Обширная сегментация отчета обеспечивает полное исследование незначительной части мирового рынка инъекций бупивакаина.

Получите бесплатную пробную копию этого отчета @ https://straitsresearch.com/report/bupivacaine-injection-market/request-sample

Key Insights

6 обусловлен увеличением доли пожилого населения, страдающего хроническими заболеваниями, увеличением числа различных видов операций и т. д.
  • Ожидается, что подсегмент инъекций 0,25% бупивакаина будет наиболее прибыльным в течение прогнозируемого периода. Его преобладание связано с ростом использования инъекций 0,25% бупивакаина для обезболивания части тела пациента до, во время или после операции, родов или стоматологических работ.
  • Ожидается, что Северная Америка будет доминировать на мировом рынке инъекций бупивакаина из-за увеличения числа пациентов и роста числа медицинских и стоматологических хирургических процедур. В регионе APAC зарегистрирован самый высокий рост в течение прогнозируемого периода.
  • Рынок насыщен многими ключевыми игроками, такими как Pfizer, Baxter, Fresenius Kabi, AstraZeneca и другими.
  • Ожидается, что растущее использование бупивакаина для инъекций будет стимулировать мировой рынок инъекций бупивакаина

    К 2030 году ожидается, что мировой рынок инъекций бупивакаина достигнет 1447 миллионов долларов США. Бупивакаин — это местный анестетик, отпускаемый по рецепту, который подавляет болевые сигналы, посылаемые в мозг. Эту инъекцию можно использовать в качестве местного или регионарного анестетика при различных процедурах, включая хирургические, диагностические, терапевтические и акушерские процедуры.Например, Bupivacaine Heavy используется в качестве интратекальной спинномозговой анестезии у взрослых и детей при операциях на нижних отделах брюшной полости, включая кесарево сечение, продолжительностью 1,5–3 часа. Он также используется для урологических операций или операций на нижних конечностях, включая операции на бедре, продолжительностью 1,5–3 часа.

    Ожидается, что общему расширению рынка будет способствовать увеличение числа процедур, выполняемых во всем мире. По данным Spine Review, ежегодно в США проводится около 1,62 миллиона хирургических операций на позвоночнике с применением инструментов.Кроме того, согласно опросу Американской академии хирургов-ортопедов (AAOS), ежегодно в Соединенных Штатах выполняется более 432 000 спондилодезов. По данным Агентства медицинских исследований и качества, в США ежегодно проводится более 790 000 операций по замене коленного сустава.

    Аналогичным образом, по данным Евростата, в 2018 году в Европе было выполнено около 1,16 миллиона кесаревых сечений. По данным Канадского института медицинской информации, было проведено 104 349 кесаревых сечений, 70 215 операций по замене коленного сустава, 55 294 вправления переломов, 42 449 ангиопластик коронарных артерий и 58 333 операции. операций по замене тазобедренного сустава проведено в стране в 2017–2018 гг.Таким образом, рост спроса на бупивакаин для инъекций для поверхностных и инвазивных процедур стимулирует рост рынка.

    В зависимости от типа мировой рынок инъекций бупивакаина делится на 0,25%, 0,5% и 0,75%.

    Бупивакаина гидрохлорид для инъекций доступен в различных формах. Ожидается, что сегмент 0,25% значительно вырастет в течение прогнозируемого периода. Для специализированного применения в ситуациях, когда необходима длительная анестезия, бупивакаин 0.25% мас./об. и 0,5% мас./об. раствор для инъекций используются для создания местной анестезии путем блокады периферических нервов, центральной нервной блокады и чрескожной инфильтрации. Блокада сенсорного нерва более заметна, чем блокада двигательного нерва. Бупивакаин чаще всего используется для лечения боли, например дискомфорта при родах.

    Каудальная эпидуральная анестезия, поясничная эпидуральная анестезия, грудная эпидуральная анестезия, полевая блокада и блокады периферических нервов используются для лечения острой боли у детей.0,5% препарат используется для блокады полей и периферических нервов у детей. Для ретробульбарной блокады рекомендуется 0,75% бупивакаин. Эта концентрация не рекомендуется для блокады лицевого нерва или других периферических нервов и местной инфильтрации.

    Купить сейчас Полный отчет @ https://straitsresearch.com/buy-now/bupivacaine-injection-market/global/

    Воздействие Covid-19

    0 Во время пандемии COVID-19 , произошли серьезные перебои в спросе на сырьевые товары на нескольких рынках конечного потребления, что затронуло глобальные сети поставок и изменила иерархию производителей.Отсутствие спроса привело к проблеме затоваривания в мировом бизнесе медицинского оборудования. Ограничения на передвижение напрямую повлияли на рынок. Кроме того, чтобы справиться с всплеском новых случаев и сэкономить ресурсы для лечения людей с положительным результатом на COVID-19, были приостановлены все неэкстренные хирургические операции в амбулаторных клиниках и больницах.

    Однако благодаря своим преимуществам и низкому риску передачи вируса местная анестезия при лечении пациентов, инфицированных SARS-CoV-2, становится все более популярной.В нескольких исследованиях было опубликовано, что бупивакаин можно использовать для сведения к минимуму количества образцов вирусного посевного материала у лиц с подозрением на COVID-19. В целом ожидается, что пандемия положительно повлияет на рыночные продукты в течение прогнозируемого периода.

    Global Bupivacaine Рынок инъекций: сегментация

    по типу

    по распределению канала

    регионов

    • Americas
    • Европа
    • Asia-Pacific
    • Средний Восток и Африка

    Список ключевых игроков

    • Pfizer Inc.
    • Fresenius Kabi AG
    • Baxter International Inc.
    • AstraZeneca, Шанхай Harvest Фармасьютикал Ко
    • Ltd, AuroMedics Pharma LLC
    • Areva
    • SteriMax Inc .

    Получите бесплатный образец копии этого отчета @ https://straitsresearch.com/report/bupivacaine-inizection-market/request-sample

    Подробную таблицу содержания
    1 Введение
    1.1 Определение рынка
    1.2 Market Scope
    2 Методология исследования
    2.1 Основные исследования
    2.2 2.1 Методология исследования
    2.3 Допущения и исключения
    2.4 2 Предположения
    3 ИСПОЛНИТЕЛЬНЫЕ ДАННЫЕ

    4 Обзор рынка
    4.1 Сообщение о сегментации и объема
    4.2      Анализ цепочки создания стоимости: Рынок инъекционного бупивакаина
    4.2.1 Матрица поставщиков
    4.3 ключевых тенденция рынка
    4.3.1 Драйверы
    4.3.2 Ограничения
    4.3.3 Возможности
    4.4 Анализ пяти сил Портера
    4.4.1 Формальная мощность поставщиков
    4.4.2 Тергативная мощность покупателей
    4.4.3 Угроза замещения
    4.4. .4  Угроза со стороны новых участников
    4.4.5  Конкурентное соперничество
    4.5      Окружающая среда и нормативно-правовая база
    4.6      Факторы прогноза и актуальность воздействия
    4.7      Макроэкономический и геополитический сценарий
    4.8 Обзор родительского рынка
    4.9 Технологический ландшафт
    4.10 Анализ акций на рынке
    4.11 Потенциальный венчурный анализ
    4.12 Региональные тенденции цен
    4.13 Тенденции сырья
    4.14 Анализ структуры затрат
    4.14.1 Стоимость труда
    4.14.2 Расходные материалы
    4.14.3 Расходные материалы
    4.15   Анализ воздействия Covid-19:
    4.15.1 Анализ рыночных сценариев до и после Covid-19
    4.15.2 График восстановления рынка и проблемы
    4.15.3 Меры, принятые ведущими игроками
    4.15.4 Квартальные доходы и прогноз доходов на рынок до 2021
    4.15.4.1 Северная Америка
    4.15.4.2 Европа
    4.15.4.3 Европа
    4.15.4.3 Азиатско-Тихоокеанский регион
    4.15.4.4 Центральная и Южная Америка и Карибский бассейн
    4.15.4.5 Средний Восток и Африка
    5 Тип Обзор
    5.1      Введение
    5.1.1 Размер рынка и прогноз (стоимость и объем)
    5.2      25%
    5.2.1  Размер рынка и прогноз (стоимость и объем)
    5.3      50%
    5.3.1 Размер рынка и прогноз (стоимость и объем)
    5.4      75 %
    5.4.1 Размер рынка и прогноз (стоимость и объем)
    6     Обзор конечного пользователя
    6.1      Введение
    6.1.1 Размер рынка и прогноз (стоимость и объем)
    6.2      Больницы
    6.2.1 Размер рынка и прогноз (стоимость и объем)
    6.3      Клиники
    6.3.1  Размер рынка и прогноз (стоимость и объем)
    6.4      Прочие
    6.4.1 Размер рынка и прогноз 5 (стоимость и объем9)
    1204 7             Региональный обзор

    7.1 ВВЕДЕНИЕ
    7.1.1 Размер рынка и прогноз (стоимость и том)
    7.2 Северная Америка
    7.2.1 Экономический обзор
    7.2.2 Сценарий рынка
    7.2.3 U.S.
    7.2.4 Canada
    7.2.5 Мексика
    7.3      Центральная и Южная Америка и Карибский бассейн
    7.3.1 Экономический обзор
    7.3.2 Рыночный сценарий
    7.3.3 Бразилия
    7.3.4 Аргентина
    7.3.5 Колумбия
    7.3.6 Остальная часть Центральной и Южной Америки и Карибского бассейна
    7.4 Europe
    7.4.1 Обзор экономики
    7.4.2 Сценарий рынка
    7.4.3 Германия
    7.4.4 Франция
    7.4.5 71419 71419 7.4.6 Италия
    7.4.7 Остальная часть Европы
    7.5 Азиатско-Тихоокеанский (APAC)
    7.5.1 Экономический обзор
    7.5.2 Рыночный сценарий
    7.5.3 Китай
    7.5.4 Япония
    7.5.5 Индия
    7.5.6 Австралия
    7.5.7 Южная Корея
    Остальные 14 AP 9 7.5.8 7.6      Ближний Восток
    7.6.1 Экономический обзор
    7.6.2 Рыночный сценарий
    7.6.3 Южная Аравия
    7.6.4 ОАЭ
    7.6.5 Катар
    7.6.6 Оман
    7.6.7 Турция
    7.6.8 Остальной Ближний Восток
    9.7 9 14 10 Африка 91 Обзор экономики
    7.7.2 Рыночный сценарий
    7.7.3 Нигерия
    7.7.4 Южная Африка
    7.7.5 Остальная часть Африки
    8         Конкурентная среда – производители и поставщики
    3 PFIZER INC
    8.3.1 Обзор бизнеса
    8.3.2 Финансовые выступления
    8.3.3 Последние разработки
    8.3.4 Портфолио
    8.4 Fresenius Kabi AG
    8.5 Baxter International Inc.
    8.6 Astrazeneca
    8.7 Shanghai Harvest Pharmaceutical Co., Ltd
    8.8 Auromedics Pharma LLC
    8.9 ASVA, STERIMAX INC.
    9 ЗАКЛЮЧЕНИЕ И РЕКОМЕНДАЦИЯ
    10 ACRONIMAMS & ABBRVIONES

    Для получения дополнительной информации, TOC, запроса или настройки перед покупкой, посещением @ HTTPS: // Straitsresearch .com/report/bupivacaine-injection-market/toc  

    Новости рынка

    • Март 2022 г. – Pfizer приобрела Arena Pharmaceuticals. Приобретение обеспечивает новый, отличительный и, возможно, лучший в своем классе метод для удовлетворения потребностей большего числа пациентов, страдающих иммуновоспалительными заболеваниями.
    • Март 2022 г. — Virpax Pharmaceuticals расширяет права на разработку и коммерциализацию AnQlarTM посредством международного лицензионного соглашения.

    News Media

    News Media

    Essaling R & D на мировом рынке вирусных вакцин, чтобы породить поразительный CAGR 8,49%
    Рынок ручек, в первую очередь приводится в действие диабетическими людьми, нуждающимися в инсулиновой терапии и менеджменте
    Набор надежных трубопроводов для развития мирового рынка лечения невралгии тройничного нерва в ближайшие годы (выявление опухоли) и регион — прогноз до 2029 г.
    Рынок вирусных вакцин : информация по типу (профилактическая вакцина, терапевтическая вирусная), показания (грипп, гепатит), способ введения, тип пациента и регион — прогноз до 2029
    Рынок лечения язв во рту : Информация по классам препаратов (противомикробные, антигистаминные), формам (спреи, жидкость для полоскания рта) и показаниям (афтозный стоматит), а также по регионам — прогноз до 2029 г.
    Рынок генетического тестирования рака ), применение (рак легких), конечные пользователи (больницы и клиники) и регионы — прогноз до 2029 г.
    Рынок оборудования для сублимационной сушки : информация по типу устройства (промышленное, лабораторное и универсальное), применение ( биотехнология, пищевая промышленность) и регион — прогноз до 2030 г.

    О компании Straits Research Pvt.Ltd.
    StraitsResearch — компания, занимающаяся изучением рынка и предоставляющая глобальные информационные отчеты и услуги. Наше эксклюзивное сочетание количественного прогнозирования и анализа тенденций обеспечивает перспективную информацию для тысяч лиц, принимающих решения. Straits Research Pvt. Ltd. предоставляет полезные данные исследования рынка, специально разработанные и представленные для принятия решений и повышения рентабельности инвестиций.
    Независимо от того, смотрите ли вы на секторы бизнеса в соседнем городе или через континенты, мы понимаем важность ознакомления с покупкой клиента.Мы преодолеваем проблемы наших клиентов, распознавая и расшифровывая целевую группу и генерируя потенциальных клиентов с максимальной точностью. Мы стремимся сотрудничать с нашими клиентами для достижения широкого спектра результатов за счет сочетания подходов к исследованию рынка и бизнеса.

    Итак, давайте соберемся вместе. Мы воплотим ваше видение в реальность и поможем вам расти.

    Телефон: +1 646 480 7505 (США)
    +91 8087085354 (APAC)
    +44 208 068 9665 (США)K.)

    Эл. facebook.com/straitsresearch/
    Instagram: https://www.instagram.com/straitsresearch/


    Что такое гипербарическая спинальная анестезия? — Первый законкомик

    Что такое гипербарическая спинальная анестезия?

    Фон.Бупивакаин — местный анестетик амидного ряда, применяемый в гипербарической и изобарической формах. Их вводят внутриоболочечно в позвоночник для обеспечения регионарной анестезии при кесаревом сечении.

    Помогает ли изобарический бупивакаин спинномозговой анестезии?

    Выводы: Как гипербарический бупивакаин, так и изобарический бупивакаин обеспечивали эффективную анестезию без различий в частоте неудач или побочных эффектов. Гипербарическая форма обеспечивает относительно быстрое начало моторного блока с более короткой продолжительностью моторного и сенсорного блока.

    Как сделать местный анестетик гипербарическим?

    Гипербарические растворы создаются путем смешивания 5-8% декстрозы с желаемым местным анестетиком. Гипербарические растворы будут течь в направлении силы тяжести и оседать в наиболее зависимых участках интратекального пространства. И наоборот, гипобарические смеси будут подниматься по отношению к гравитационному притяжению.

    Как долго действует изобарический бупивакаин?

    Продолжительность блокады, часов Для неосложненной ревизии 3.5-4 мл 0,5% изобарического бупивакаина (17,5-20 мг) надежно производят хирургическую блокаду на 3-4 часа. При потенциально более длительных процедурах 5 мл 0,5% изобарического бупивакаина (25 мг) обеспечивают хирургическую блокаду на 4-6 часов.

    Почему бупивакаин тяжелый?

    Bupivacaine Heavy является гипербарическим, и на его начальное распространение в интратекальном пространстве влияет гравитация. Из-за небольшой дозы интратекальное распространение приводит к относительно низкой концентрации, а продолжительность местной анестезии, как правило, относительно короче.

    Каковы побочные эффекты бупивакаина?

    Побочные эффекты

    • Жжение, ползание мурашек, зуд, онемение, покалывание, «мурашки по коже» или покалывание.
    • изменение или потеря вкуса.
    • боль или дискомфорт в груди.
    • непрекращающийся звон, жужжание или другой необъяснимый шум в ушах.
    • уменьшение частоты и количества мочи.
    • затрудненное или болезненное мочеиспускание.
    • повышенная жажда.

    Что такое барботаж спинного мозга?

    [ bär′bə-täzh′ ] сущ.Производство спинномозговой анестезии, при котором часть раствора анестетика вводят в спинномозговую жидкость, которая затем аспирируется в шприц и вводится вторая порция содержимого шприца.

    Является ли 0,75% бупивакаин гипербарическим?

    Хотя 0,75% гипербарический раствор бупивакаина обычно вводят для обеспечения спинномозговой анестезии при кесаревом сечении в США, в некоторых странах доступен только 1% гипербарический раствор спинального бупивакаина.

    Как делать спинальную анестезию?

    Спинномозговая анестезия проводится анестезиологом. В середину поясницы вводится очень тонкая игла, и через нее в жидкость, окружающую спинной мозг, вводится местный анестетик. Местный анестетик вызывает онемение нервов, которые иннервируют живот, бедра, ягодицы и ноги.

    Каким путем проводится спинномозговая анестезия?

    Спинальная анестезия (или спинальная анестезия), также называемая спинальной блокадой, субарахноидальной блокадой, интрадуральной блокадой и интратекальной блокадой, представляет собой форму нейроаксиальной регионарной анестезии, включающую инъекцию местного анестетика или опиоида в субарахноидальное пространство, как правило, через тонкую иглу, обычно 9 см (3.5 дюймов) в длину.

    Почему бупивакаин тяжелый?

    Является ли бупивакаин таким же, как лидокаин?

    Ксилокаин и маркаин — это одно и то же? Ксилокаин (лидокаин) и маркаин (бупивакаина гидрохлорид) являются местными анестетиками (обезболивающими лекарствами, применяемыми в одной области). Маркаин действует дольше и используется для спинальной блокады. Лидокаин используется для местной или регионарной анестезии.

    Гипербарический или изобарический бупивакаин более эффективен для анестезии?

    Выводы: Как гипербарический бупивакаин, так и изобарический бупивакаин обеспечивали эффективную анестезию без различий в частоте неудач или побочных эффектов.Гипербарическая форма обеспечивает относительно быстрое начало моторного блока с более короткой продолжительностью моторного и сенсорного блока.

    В чем разница между гипербарической и изобарической формулой?

    Гипербарическая форма обеспечивает относительно быстрое начало моторного блока с более короткой продолжительностью моторного и сенсорного блока. Изобарическая форма имеет более медленное начало действия и обеспечивает большую продолжительность как сенсорного, так и моторного блока.

    Как влияет изобарический состав на сенсорную и моторную блокаду?

    Изобарическая форма имеет более медленное начало действия и обеспечивает большую продолжительность как сенсорной, так и моторной блокады.Тем не менее, небольшой размер выборки и высокая гетерогенность этих исходов предполагают, что ко всем результатам следует относиться с осторожностью. Типы публикаций

    Как проводить спинномозговую блокаду под анестезией?

    спинальная анестезия. Перед началом спинальной блокады тщательно вымойте руки. Пациент должен быть подключен к стандартным мониторам, включая ЭКГ, артериальное давление и пульсоксиметрию. Запишите первоначальный набор основных показателей жизнедеятельности. Предварительно нагрузите пациента 1-1.5 литров кристаллоидного раствора для внутривенного введения.